Detection of Human Herpes Virus type-6 in Patients Undergoing Hemodialysis

Javid, Naeme; Mohebbi, Alireza; Eskandarian, Samira; Tahamtan, Alireza; Askari, Fatemeh Sana; Moradi, Abdolvahab; Ahmadi, A; Kilishadi, Mishar; Tabarraei, Alijan

doi:10.2217/fvl-2017-0153

Cited by 1 publication

(1 citation statement)

References 27 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…For each sample, 600 ng of RNA was used for cDNA synthesis. The cDNA synthesis was further confirmed by the amplification of the GAPDH gene [20]. Expression of the HBsAg gene was evaluated in controlled and treated cells with SYBR Green qPCR Master Mix Kit (Yekta-Tajhiz Inc., Tehran, Iran) and a specific primer pair (forward: TGTTCAGTGGTTCGTAGGGC and reverse: ACAGCGGCATAAAGGGCATC).…”

Section: Methodsmentioning

confidence: 99%

Havachoobe (Onosma dichroanthum Boiss) Root Extract Decreases the Hepatitis B Virus Surface Antigen Secretion in the PLC/PRF/5 Cell Line

et al. 2020

Self Cite

View full text Add to dashboard Cite

Background: Many efforts are currently focused on functional treatment of the hepatitis B virus (HBV). This can be done by suppressing the secretion of HBV surface antigen (HBsAg). Scientific communities are very interested in natural products in that respect. Objective: Use of root extract of Havachoobe (Onosma dichroanthum BoissI), a Northern Iranian native medical herb, for assessment of its anti-HBsAg secretion activity. Methods: Havachoobe had been bought at a nearby apothecary store. Plant root extract was obtained using a hydroalcoholic process. Cytotoxic activity of the extract was examined on PLC/PRF/5 cells using MTT assay. ELISA has been used to measure HBsAg in the treated cell line supernatants. In addition, real-time PCR analysis was performed to evaluate the expression of HBsAg before and after treatment of Onosma in vitro. Results: The results showed very low root extract cytotoxicity at concentrations under 8 μg/mL. Tissue culture infectious dose 50 was obtained at 63.78 μg/mL. In a dose-dependent and time-dependent manner, a significantly reduced HBsAg secretion was observed at a concentration of 8 ppm at 12 h post-treatment. The real-time PCR result showed relative decreased HBsAg expression at all doses at 12 h post-treatment time. Discussion: In this study, we first reported anti-HBsAg activity on an Iranian herbal medicine. Havachoobe root extract was shown to be able to inhibit HBsAg in a dose-dependent and time-dependent manner. We find the extract exerts its inhibitory effect of HBsAg by targeting transcription of HBsAg.

show abstract

Section: Methodsmentioning

confidence: 99%