Detection of human polyomaviruses <scp>JC</scp> and <scp>BK</scp> in liver pretransplant patients

Figueiredo, Marilia Andrade; Fink, Maria Cristina Domingues da Silva; Castro, Talita; Braz‐Silva, Paulo Henrique; Steffens, Juliana; Eduardo, Fernanda de Paula; Gallottini, Marina; Ortega, Karem L.

doi:10.1111/odi.12707

Cited by 13 publications

(8 citation statements)

References 26 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…When oral fluids are used in screening assays to detect polyomaviruses, the results are highly positive and are especially indicated for patients who are unable to urinate. This positivity in oral fluids occurs even when the patient has negative viremia, which indicates that saliva can be a means for early detection of BKPyV 2 , 3 .…”

Section: Discussionmentioning

confidence: 99%

“…In our study, 46.8% of the participants excreted the virus in their oral fluids, which is a lower percentage than that observed in literature. Diseases related to BKPyV may be associated with a specific immune deficiency as a result of the use of immunosuppressive drugs 3 , 17 .…”

Section: Discussionmentioning

confidence: 99%

“…Detection and quantification of BKPyV were performed by using a real-time PCR, and laboratory procedures were conducted at the Laboratory of Virology of the University of São Paulo Institute of Tropical Medicine (IMT-USP) 2 , 3 . DNA extraction was performed using the QIAamp DNA extraction QIAGEN kit, according to protocol for RT-qPCR in which primers and specific probes are used to detect the gene encoding the Ag-T protein of the BKPyV, resulting in a 80-pb fragment (Forward: 5-GAAACTGAAGACTCTGGACATGGA-3; Reverse: 5-GGCTGAAGTATCTGAGACTTGGG-3; BKPyV probe: CAAGCACTGAATCCCAATCACAATGCTC) 9 .…”

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

BK virus salivary shedding and viremia in renal transplant recipients

et al. 2019

View full text Add to dashboard Cite

Objectives: This study aimed to verify the presence of polyomavirus BK (BKPyV) in the saliva of kidney transplant recipients and to correlate it with blood viremia. Material and Methods: We have conducted a cross-sectional study with a sample involving 126 renal transplant recipients. 126 samples of saliva and 52 samples of blood were collected from these patients. Detection and quantification of BKPyV were performed using a real-time PCR. To compare the presence of BKPyV in blood and saliva, the binomial proportion test was used. To verify associations between salivary shedding BKPyV and post-transplant periods (in months), the Mann-Whitney test was used. Spearman's correlation was used to correlate the viral load in the saliva with blood of kidney transplant recipients. Results: The mean age of the study group was 51.11±12.45 years old, and 69 participants (54.8%) were female, with a mean post-transplantation time of 4.80±6.04 months. BKPyV was quantified in several samples of saliva and blood, with medians of 1,108 cp/mL and 1,255 cp/mL, respectively. Only 16/52 (30.8%) participants presented BKPyV in blood, and 59/126 (46.8%) excreted the virus in saliva (p=0.004). BKPyV shedding was found in patients at a shorter post-transplantation period (3.86±5.25, p=0.100). A weak correlation was observed between viral quantification in saliva and blood (Spearman's correlation coefficient=0.193). Conclusion: The results of this study suggested that, although saliva excretes more BKPyV than blood, there is no reliable correlation between salivary shedding and blood viremia, showing two independent compartments of viral replication.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

BK virus salivary shedding and viremia in renal transplant recipients

et al. 2019

View full text Add to dashboard Cite

show abstract

“…An increasing evidence has suggested that there is a connection between human polyomaviruses and the oral compartment [1,[24][25][26][27][28], meaning that saliva can be used as an additional biological fluid to assess the polyomavirus status. Therefore, saliva has gained an increased interest as a non-invasive screening approach to facilitate detection of new cases and monitor previously known cases [19].…”

Section: Introductionmentioning

confidence: 99%

Detection of polyomavirus microRNA-5p expression in saliva shortly after kidney transplantation

Mamana

Stincarelli

Sarmento

et al. 2021

Journal of Oral Microbiology

View full text Add to dashboard Cite

Background: MicroRNAs (miRNAs) of polyomavirus (PyV) are present in several biological fluids and are suggested to be relevant viral factors for monitoring its persistence. Aim: To evaluate the effect of an immunosuppressive regimen on the status of PyV-miRNA-5p in the oral cavity. Materials and Methods: The JCPyV, BKPyV, MCPyV miRNA-5p were investigated in paired saliva and plasma samples obtained from 23 patients before and shortly after renal-transplantation by using real-time RT-PCR. Results: Overall, within a short-time after transplantation, patients exhibited decreased numbers of leukocyte and lymphocyte as well as low levels of creatinine. During the clinical management of the patients, a significant amount of saliva samples were positive for JCPyV and BKPyV miRNA-5p (range: 26%-91%) compared to paired plasma samples (range: 9%-35%). Among the two polyomaviruses showing positive expression of miRNA-5p, BKPyV presented the highest positivity in saliva (91%) and MCPyV-miRNA-5p was constantly negative in both saliva and plasma samples. Compared to the time before transplantation, a significant reduction in the expression of JCPyV-miRNA-5p was observed in saliva samples obtained after transplantation. Conclusions: Altogether, these data suggest that additional investigations of polyomavirus miRNA-5p in saliva should be performed shortly after renal-transplantation to evaluate the potential role in early viral reactivation.

show abstract

“…Parece que é exatamente isso que vem acontecendo nos últimos anos. Notase que existe uma atenção crescente para a saúde bucal do paciente cirrótico em fila de transplante (Lins et al, 2011;Silva Santos et al, 2012;Helenius-Hietala et al, 2012;Helenius-Hietala et al, 2013;Helenius-Hietala et al, 2014;Olczak-Kowalczyk et al, 2014;Aberg et al, 2014;Grønkjaer, 2015;Grønkjaer;Vilstrup, 2015;Han et al, 2016;Figueiredo et al, 2017;Di Profio et al, 2017;Lins et al, 2017). (Yi et al, 2017).…”

Section: Critérios De Exclusãounclassified

Sangramento pós-exodôntico em pacientes em fila de transplante hepático: análise retrospectiva

Medina¹

View full text Add to dashboard Cite

Hepatic cirrhosis is the result of all long-term chronic diseases, which can compromise the liver, and is characterised by hepatic insufficiency (HI) and portal hypertension (PH). The coagulopathies seen in cirrhotic patients depend on several mechanisms involving both HI and PH, which impairs the routine physiological functions of the liver, such as synthesis of all coagulation factors, except the von Willebrand factor. All dental studies published until today could not associate the two tests commonly used prior to tooth extraction in these patients, namely, INR and platelets count, for presence of haemorrhagic events. The objective of this work was to assess the presence of intra-and post-operative bleeding in cirrhotic patients undergoing tooth extraction and to verify whether there exists an association between laboratory (i.e. platelets, haemoglobins, INR, TTPa, urea, creatinine) and clinical parameters (i.e. cirrhosis complications, disease stage, MELD score, type of tooth extraction, surgery time, number of teeth extracted). This is a cross-sectional, retrospective, observational study of cirrhotic patients who were on the liver transplant waiting list at the Healthcare Centre for Special Patients (CAPE) of the University of São Paulo Faculty of Dentistry (FOUSP). Data were obtained from the medical records of 224 patients and the Epi Info software was used to generate a database. A total of 190 visits were performed for 99 patients, resulting in 333 teeth extracted. The majority of the patients were male (75.44%) with mean age of 51.27 years old and elementary education level (23.56%). The greatest cause was hepatitis C (40.18%) and the most common cirrhosis complications were collateral circulation (66.80%), hepatic encephalopathy (56.30%) and ascite (64.20%). Plateletopenia (95.80%) was identified in 190 blood counts, anaemia (67.90%) in 129, and white blood cell changes in 110 (57.80%). The mean scores for INR was 1.45 (minimum 1.03 and maximum 2.71) and for platelets was 76,380 (minimum 16,000 and maximum 216,000). Only 12 patients presented haemorrhagic events during surgery and 12 after it. The only positive association was found between platelet counts and intra-operative haemorrhagic events (P = 0.26; Mann Whitney's test, confirmed with linear regression analysis). All the bleeding events were controlled with local measures. Cirrhotic patients who were on the liver transplant waiting list had a few bleeding events, all with little severity. Intra-operative haemorrhagic events are more likely to occur when the platelet count is low, but bleeding can be handled with simple local measures. Post-operative haemorrhagic events could not be associated with any variable, but no patient needed blood transfusion as the clinical picture improved spontaneously.

show abstract

Detection of human polyomaviruses JC and BK in liver pretransplant patients

Abstract: Cirrhotic patients on the liver transplant waiting list did not show higher prevalence of BKPyV and JCPyV compared to normoreactive controls.

Cited by 13 publications

References 26 publications

BK virus salivary shedding and viremia in renal transplant recipients

BK virus salivary shedding and viremia in renal transplant recipients

Detection of polyomavirus microRNA-5p expression in saliva shortly after kidney transplantation

Sangramento pós-exodôntico em pacientes em fila de transplante hepático: análise retrospectiva

Contact Info

Product

Resources

About