Detection of<i>Staphylococcus lugdunensis</i>by a new species-specific PCR based on the<i>fbl</i>gene

Pereira, Elisabete Monteiro de Aguiar; Oliveira, Fred L.F.; Schuenck, Ricardo Pinto; Zoletti, Gustavo O.; Santos, Kátia Regina Netto dos

doi:10.1111/j.1574-695x.2009.00626.x

Cited by 21 publications

(14 citation statements)

References 9 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Fbl and ClfA have similar binding affinities to fibrinogen, and both interact with the C-terminus of the γ-chain (67). Fbl also is used as a species-specific detection method for S. lugdunensis (68, 69). …”

Section: Staphylococcal Adhesinsmentioning

confidence: 99%

The Staphylococcal Biofilm: Adhesins, Regulation, and Host Response

2016

View full text Add to dashboard Cite

The Staphylococci comprise a diverse genus of Gram-positive, non-motile commensal organisms that inhabit the skin and mucous membranes of humans and other mammals. In general, Staphylococci are benign members of the natural flora, but many species have the capacity to be opportunistic pathogens, mainly infecting individuals who have medical device implants or are otherwise immunocompromised. S. aureus and S. epidermidis are a major source of hospital-acquired infections and are the most common causes of surgical site infections and central line-associated bloodstream infections. The ability of Staphylococci to form biofilms in vivo makes them highly resistant to chemotherapeutics and leads to chronic diseases. These biofilm infections include osteomyelitis, endocarditis, medical device implants, and persistence in the cystic fibrosis lung. Here, we provide a comprehensive analysis of our current understanding of Staphylococcal biofilm formation, with an emphasis on adhesins and regulation, while also addressing how Staphylococcal biofilms interact with the immune system. On the whole, this review will provide a thorough picture of biofilm formation of the Staphylococcus genus and how this mode of growth impacts the host.

show abstract

Section: Staphylococcal Adhesinsmentioning

confidence: 99%

The Staphylococcal Biofilm: Adhesins, Regulation, and Host Response

2016

View full text Add to dashboard Cite

show abstract

“…S. lugdunensis is an unusually virulent coagulase-negative species, associated with severe infection. So, using single-step, species-specific PCR protocol for S. lugdunensis identification is very important [15]. …”

Section: Resultsmentioning

confidence: 99%

“…For ( fbl F : GTAAATAGCGAGGCACAAGC, fbl R : GGTAAATCGTATCTGCCGCT) 425 bp, the conditions were 94°C 3 min 1x, 94°C 1 min, 60°C 1 min 30x, 72°C 1 min, and 72°C 5 min 1x [15]. For ( mecA F : TCCAGGAATGCAGAAAGACCAAAGC, mecA R : GACACGATAGCCATCTTCATGTTGG) 499 bp, the conditions were 94°C 3 min 1x, 94°C 1.5 min, 55°C 1 min 36x, 72°C 1 min, and with final step 72°C 10 min 1x [16].…”

Section: Methodsmentioning

confidence: 99%

First Record of Isolation and Characterization of Methicillin ResistantStaphylococcus lugdunensisfrom Clinical Samples in Iraq

Al-Charrakh

Obayes

2014

BioMed Research International

View full text Add to dashboard Cite

This study was conducted to determine the frequency of Staphylococcus lugdunensis in different clinical samples. Out of 690 clinical samples, a total of 178 coagulase negative staphylococci (CoNS) isolates were recovered. CoNS were identified as 10 different species; 22 isolates belonged to Staphylococcus lugdunensis. Two specific genes for S. lugdunensis were used ( tanA gene and fbl gene) to confirm identification. Both of these specific genes were detected in 15 (68.1%) of 22 isolates that were identified phenotypically. The results of oxacillin MIC showed that 7 of the 15 (46.6%) S. lugdunensis isolates were oxacillin resistant. The antibiotic susceptibility testing against 16 antibiotics showed that resistance rates were variable towards these antibiotics. Eight of fifteen S. lugdunensis isolates (53.3%) were β-lactamase producer. Results of molecular detection of mecA gene found that mecA gene was detected in 6 (40%) of 15 S. lugdunensis. All of these 6 isolates (S1, S2, S3, S4, S5, and S6) were resistant to oxacillin. One isolate (S7) was resistant to oxacillin but mecA was not detected in this isolate. This study is a first record of isolation and characterization of methicillin resistant S. lugdunensis (MRSL) from clinical samples in Iraq.

show abstract

“…It gave a positive reaction for clumping factor, but the tube coagulase test was negative. Then, the isolate was evaluated using the method based on the conventional reference tests 2 and the ornithine decarboxylase production, an enzyme produced only by S. lugdunensis strains. 3 To confirm the species identification, the fbl gene, which encodes a fibrinogen binding protein of S. lugdunensis was amplified by PCR as previously published.…”

mentioning

confidence: 99%

Methicillin-resistant Staphylococcus lugdunensis carrying SCCmec type V misidentified as MRSA

Pereira¹,

Schuenck²,

Nouér³

et al. 2011

Braz J Infect Dis

View full text Add to dashboard Cite

Staphylococcus lugdunensis is a rare cause of severe infections and clinical manifestations are similar to those related to S. aureus infection. We describe a hospital-acquired bacteremia due to methicillin-resistant Staphylococcus lugdunensis, misidentified as methicillin-resistant S. aureus. The oxacillin MIC was 16 µg/mL and the mecA gene and SCCmec type V were determined by PCR. Although treatment had been appropriated, the patient died after rapid progressive respiratory failure and another nosocomial sepsis. It is important not only to identify S. lugdunensis in view of its clinical course, but also to determine its susceptibility to oxacillin by detecting the mecA gene or its product.

show abstract

Detection ofStaphylococcus lugdunensisby a new species-specific PCR based on thefblgene

Cited by 21 publications

References 9 publications

The Staphylococcal Biofilm: Adhesins, Regulation, and Host Response

The Staphylococcal Biofilm: Adhesins, Regulation, and Host Response

First Record of Isolation and Characterization of Methicillin ResistantStaphylococcus lugdunensisfrom Clinical Samples in Iraq

Methicillin-resistant Staphylococcus lugdunensis carrying SCCmec type V misidentified as MRSA

Contact Info

Product

Resources

About