Detection of Mycobacterium tuberculosis and Mycobacterium bovis from sputum and blood samples of human using a Duplex PCR

A one health-focused literature review on bovine and zoonotic tuberculosis in Pakistan from the past two decades: challenges and way forward for control

“… Gujranwala and Hafizabad districts (Punjab) Target population: suspected TB patients Sample size: 335 Sample collected: sputum, pus, fluid from lymph nodes, peritoneal effusion and pleural effusion while samples could not be collected from 11 patients Tests conducted: ZN staining and PCR Out of 324 TB positive patients 244 had pulmonary TB while 91 were cases of extra pulmonary TB Out of 324 samples that tested positive on ZN staining, 7.4% ( n = 24) were positive for M. bovis on PCR Out of 244 pulmonary TB patients only 5 were detected positive for M. bovis while out of 91 extra pulmonary TB patients 16 detected positive for M. bovis Prevalence of M. bovis in cases of extra-pulmonary TB is very high compared to pulmonary TB [ 71 ] 7. Lahore (Punjab) Target population: suspected TB patients Sample size: 100 Sample collected: 200 samples (100 blood and 100 sputum samples) Tests conducted: culture (LJ and stone brink media; followed by niacin accumulation and nitrate reduction tests), ZN staining and PCR Out of 100 sputum samples, 37% ( n = 37) were positive for M. tb and 5% ( n = 5) were positive for M. bovis by PCR From 100 blood samples, 4% (n = 4) were found M. bovis positive by PCR On culture, 11 sputum samples were found positive for M. tb The authors reported a sensitivity of 100% and specificity of 70.79% for Duplex PCR test with a positive and negative predictive value of 29.73 and 100% respectively [ 77 ] …”

Molecular identification and infection pathology of Mycobacterium spp. in captive wild animals in Pakistan

“…K0721, Thermo Fisher Scientific, Waltham, USA). The PCR was performed with little modification of previously described protocols for the identification of M. bovis and M. tuberculosis DNA [18,25]. Separate PCR reactions were carried out using primer sets (JB21(TCGTCCGCTGATGCAAGTGC)-FW, JB22(CGTCCGCTGACCTCAAGAAG)-RV and pncATB-1.2 (ATGCGGGCGTTGATCATCGTC)-FW, pncAMT-2 (CGGTGTGCCGGAGAAGCGG)-RV for M. bovis (500 bp) and M. tuberculosis (185 bp), respectively.…”

“…Separate PCR reactions were carried out using primer sets (JB21(TCGTCCGCTGATGCAAGTGC)-FW, JB22(CGTCCGCTGACCTCAAGAAG)-RV and pncATB-1.2 (ATGCGGGCGTTGATCATCGTC)-FW, pncAMT-2 (CGGTGTGCCGGAGAAGCGG)-RV for M. bovis (500 bp) and M. tuberculosis (185 bp), respectively. Briefly, a reaction mixture of 50 µL was prepared to contain 5 µL of Taq buffer, 300 mM dNTP, 1.5 mM MgCl 2, 2.5 U Taq polymerase (Thermo Fisher Scientific, Waltham, USA), 5% DMSO, 1.5 µL of each primer (20 µM) and 2 µL of template DNA [18]. Amplification of DNA was carried out by a gradient thermocycler (SCILOGEX SCI 1000-S, Rocky Hill, USA).…”

“…Among animals, prevalence varies from as low as 5% to as high as 95% in various parts of the world [6,17]. In Pakistan, TB has been detected in wildlife in Islamabad Zoo and the results showed a prevalence of 3.6% and 3.2% in the Bovidae and Cervidae families, respectively [18]. Similarly, in Lahore Zoo, 30% and 20% of antelopes were found positive for tuberculosis caused by M. bovis and M. tuberculosis, respectively [10].…”

Molecular detection and characterization of the Mycobacterium tuberculosis complex subspecies responsible for bovine tuberculosis in Punjab, Pakistan

“…Throughout Pakistan, M. bovis has previously been reported as the sole cause of zoonotic ( 20 ) and bovine TB ( 21 ). The majority of investigations in Pakistan used PCR with the JB21 and JB22 primers to detect zoonotic or bovine TB in human and animal samples ( 22 – 24 ). These primers were previously reported to amplify an M. bovis -specific 500-bp sequence ( 25 ).…”