Detection of Mycobacterium tuberculosis by PCR amplification with pan-Mycobacterium primers and hybridization to an M. tuberculosis-specific probe

Abstract

Nucleic acid amplification techniques such as the PCR are very useful in the rapid diagnosis of infections by Mycobacterium tuberculosis. However, recent studies have shown that the accuracy of results can vary widely when tests are performed with nonstandardized reagents. We have developed a PCR assay for the detection of M. tuberculosis that is both rapid and accurate. The assay reagents are standardized and quality controlled. False-positive results due to carryover contamination are prevented by the incorporation of dUTP coupled with uracil-N-glycosylase restriction. This assay also employs pan-Mycobacterium amplification primers, allowing for flexibility in the mycobacterial species that can be identified from a single amplification reaction. The amplification is very sensitive; amplification products generated from as few as three bacteria can be detected by agarose gel electrophoresis. DNAs isolated from 33 of 34 mycobacterial species tested were amplified efficiently. Only DNA from Mycobacterium simiae did not amplify. The amplification is also very specific. Amplification products were generated only from the DNAs of bacteria in closely related genera such as Corynebacterium. The nonmycobacterial amplicons do not pose a problem, as they do not hybridize to mycobacterium-specific probes. Hybridization of amplicons to an M. tuberculosis-specific probe allows for the unambiguous identification of M. tuberculosis complex organisms. The clinical performance of this PCR assay was evaluated against that of culture in 662 respiratory specimens. Sensitivities of 100 and 73.1% were obtained from smear-positive and-negative respiratory specimens, respectively. The corresponding specificities were 100 and 99.8%. The high sensitivity and specificity, coupled with the potential for detecting a wide range of mycobacteria, make this assay a useful tool in the clinical management of mycobacterial infections.

Polymerase Chain Reaction Detection of Mycobacterium tuberculosis From Fine‐Needle Aspirate for the Diagnosis of Cervical Tuberculous Lymphadenitis

“…Thus PCR revealed 76.4% sensitivity and 100% specificity. Similar results were reported by Tevere et al 10 PCR tests of respiratory tract specimens in their study showed 73.1% sensitivity in the AFB smear‐negative group. Tan et al 8 used a different PCR method and reported 100% sensitivity and from 95% to 85% specificity for various specimens such as sputum, bronchoalveolar lavage fluid, pleural fluid, and gastric aspirate.…”

“…Tötsch et al 7 performed two different PCR methods with paraffin‐embedded lymph node tissues and reported 100% sensitivity. Tevere 10 and Wobeser et al 11 presented a PCR method with Pan‐ Mycobacterium primer and M tuberculosis ‐specific probe and reported 91.9% sensitivity and 99.8% specificity using 662 respiratory tract specimens. These reports, however, did not present new methods for replacing the established diagnostic tools; rather they are considered preliminary studies for clinical applications, because of their use of surgical biopsy specimens.…”

“…In the present study, we performed the PCR method presented by Tevere et al, 10 with the remainder of specimen obtained from fine‐needle aspiration as an initial diagnostic test for cervical tuberculous lymphadenitis. Among the 17 patients who were clinically diagnosed as having cervical tuberculous lymphadenitis, 13 patients showed positive findings on PCR.…”

“…The needle was not replaced until all preparations were performed. PCR was performed at the Department of Clinical Pathology at Samsung Medical Center according to the manufacturer's instructions with the Roche Amplicor M tuberculosis PCR test kit (Roche PCR Diagnostics, Branchburg, NJ) 10,11 . Primers KY18 (5′‐CACATGCAAGTCGAACGGAAAGG‐3′) and KY75(5′‐GCCGTATCGCCCGCACGCTCACA‐3′) were derived from regions of the 16S rRNA gene that are conserved among mycobacterial species.…”

The use of alkaline phosphatase-labelled oligonucleotide probes as culture confirmation reagents for the identification of commercially important bacteria

“…The universal eubacterial 16S primers (Edwards et al 1989) were used to amplify rDNA from most of the strains tested. Genus-specific 16S primers (Tevere et al 1996) were used to amplify Mycobacterium DNA, and 23S primers (Ludwig et al 1993) were used to amplify rDNA for the screening of the Vibro vulnificus-specific probe. The amplified DNA (1 ml) was spotted onto a nylon membrane (Hybond-N, Amersham International) and fixed by u.v.…”