Detection of plant parasitic nematodes,<i>Meloidogyne incognita</i>and<i>Pratylenchus coffeae</i>by multiplex PCR using specific primers

Saeki, Yuichi; Kawano, Eiji; Yamashita, Chigusa; Akao, Shoichiro; Nagatomo, Yasuhiro

doi:10.1080/00380768.2003.10410010

Cited by 17 publications

(6 citation statements)

References 8 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Primers in real‐time PCR should be designed to produce 100–200 bp (Takara Bio, Otsu, Japan). Specific primers designed for G. rostochiensis by Bulman and Marshall (1997) produce more than 250 bp of PCR product and those for M. incognita designed by Saeki et al . (2003) produce more than 500 bp.…”

Section: Methodsmentioning

confidence: 99%

Development of a real-time PCR method for the potato-cyst nematodeGlobodera rostochiensisand the root-knot nematodeMeloidogyne incognita

Toyota

Shirakashi

Sato

et al. 2008

Soil Science and Plant Nutrition

View full text Add to dashboard Cite

The primers PCN280f and NEPCN398r were designed for the quantitative detection of the potato-cyst nematode Globodera rostochiensis using real-time polymerase chain reaction (PCR). One, five, 50, 125 and 250 individuals of the second-stage juveniles (J2) of G. rostochiensis were mixed with various stages of vermiform Caenorhabditis elegans to make a total of 500 individuals and DNA was extracted from the nematode mixture. There was a significant correlation (r 2 = 0.9355, P < 0.001) between the threshold cycle values and the number of G. rostochiensis added. When nematodes were extracted from soils artificially infested with G. rostochiensis to various degrees and real-time PCR was conducted using DNA templates from the nematodes extracted, there was a highly significant correlation in the numbers of G. rostochiensis J2 from the real-time PCR method and morphological identification. Real-time PCR sensitively detected a single G. rostochiensis J2 out of 1,000 individuals of free-living nematodes. Similarly, real-time PCR primers RKNf and RKNr were designed for the detection of the root-knot nematode Meloidogyne incognita. This study demonstrated that the real-time PCR assay for the potato-cyst nematode and the root-knot nematode provides a sensitive and reliable means for the rapid quantification of these vermiform pests.

show abstract

Section: Methodsmentioning

confidence: 99%

Development of a real-time PCR method for the potato-cyst nematodeGlobodera rostochiensisand the root-knot nematodeMeloidogyne incognita

Toyota

Shirakashi

Sato

et al. 2008

Soil Science and Plant Nutrition

View full text Add to dashboard Cite

show abstract

“…Genomic DNA was extracted from approximately 300 nematode individuals using FavorPrep Tissue Genomic DNA Extraction Mini Kit (Favorgen), following the manufacturer's protocol. PCRs were carried out to amplify ITS (forward primer ITS‐F: 5′‐TGTAGGTGAACCTGCTGCTGGATC‐3′ and reverse primer ITS‐R: 5′‐CCTATTTAGTTTCTTTTCCTCCGC‐3′) or oesophageal gland protein SEC 1 (forward primer SEC1‐F: 5′‐GGGCAAGTAAGGATGCTCTG‐3′ and reverse primer SEC1‐R: 5′‐GCACCTCTTTCATAGCCACG‐3′) gene region of genomic DNA for molecular identification (Saeki et al, 2003; Tesařová et al, 2003). Briefly, 25‐μL reactions contained 12.5 μL of MyTaq 2× Master mix (Bioline), 20 ng genomic DNA, 0.5 μM of each primer and water.…”

Section: Methodsmentioning

confidence: 99%

Identification of Piper species that are resistant to Phytophthora capsici, Meloidogyne incognita, and waterlogging in Vietnam

et al. 2023

View full text Add to dashboard Cite

Black pepper (Piper nigrum) is a spice commonly used in kitchens throughout the world. Black pepper production is devastated by a range of pathogenic agents, including Phytophthora capsici and Meloidogyne incognita. Many efforts have been directed towards finding black pepper cultivars that are resistant to these pathogens. In this work, a 39‐accession germplasm panel of species in the Piper family collected throughout Vietnam was described. Preliminary tests using P. capsici inoculation onto leaves were carried out to identify potentially resistant accessions. Next, candidate plants were inoculated with P. capsici mycelial suspension and survival rates were assessed 15, 30 and 45 days postinoculation. In addition, Piper plants were challenged with M. incognita by adding larvae/juveniles to growing pots. Resistance to M. incognita was determined by the number of root galls and the percentage of plants with yellow leaves 1, 2 and 4 months after treatment. Piper accessions were also subjected to a 4‐day waterlogged treatment. Two accessions (HUIB_PH30 and HUIB_PD36) demonstrated high levels of resistance to all biological and water stresses. Micromorphological characterizations revealed that the amount of intercellular spaces in the root cortex correlated with the resistance to P. capsici and waterlogging tolerance. Hence, the abundance of intercellular spaces can serve as a guide for further selection of black pepper accessions that are resistant to common diseases and tolerant to waterlogged conditions.

show abstract

“…Meloidogyne incognita was collected and identified based on the method described by Saeki et al. (2003) from roots of the oriental melon ( Cucumis melo L. var.…”

Section: Methodsmentioning

confidence: 99%

Assessment of nematicidal and plant growth-promoting effects of Burkholderia sp. JB-2 in root-knot nematode-infested soil

et al. 2023

View full text Add to dashboard Cite

Root-knot nematodes (RKN), Meloidogyne spp., are plant-parasitic nematodes that are responsible for considerable economic losses worldwide, because of the damage they cause to numerous plant species and the inadequate biological agents available to combat them. Therefore, developing novel and eco-friendly nematicides is necessary. In the present study, Burkholderia sp. JB-2, isolated from RKN-infested rhizosphere soil in South Korea, was evaluated to determine its nematicidal and plant growth-promoting effects under in vitro and in vivo conditions. Cell-free filtrates of the JB-2 strain showed high levels of nematicidal activity against second-stage juveniles (J2) of M. incognita, with 87.5% mortality following two days of treatment. In addition, the assessment of the activity against other six plant parasitic nematodes (M. javanica, M. hapla, M. arenaria, Ditylenchus destructor, Aphelenchoides subtenuis, and Heterodera trifolii) showed that the cell-free filtrates have a broad nematicidal spectrum. The three defense-responsive (MiMIF-2, MiDaf16-like1, and MiSkn1-like1) genes were activated, while Mi-cm-3 was downregulated when treated with cell-free filtrates of JB-2 cultures on J2. The greenhouse experiments suggested that the cell-free filtrates of the JB-2 strain efficiently controlled the nematode population in soil and egg mass formations of M. incognita in tomato (Solanum lycopersicum L., cv. Rutgers). An improvement in the host plant growth was observed, in which the shoot length and fresh weights of shoots and roots increased. The treatment with 10% of JB-2 cell-free filtrates significantly upregulated the expression levels of plant defenses (SlPR1, SlPR5, and SlPAL) and growth-promoting (ACO1, Exp18, and SlIAA1) genes compared with the corresponding parameters of the control group. Therefore, JB-2 could be a promising candidate for the sustainable management of RKN.

show abstract

Detection of plant parasitic nematodes,Meloidogyne incognitaandPratylenchus coffeaeby multiplex PCR using specific primers

Cited by 17 publications

References 8 publications

Development of a real-time PCR method for the potato-cyst nematodeGlobodera rostochiensisand the root-knot nematodeMeloidogyne incognita

Development of a real-time PCR method for the potato-cyst nematodeGlobodera rostochiensisand the root-knot nematodeMeloidogyne incognita

Identification of Piper species that are resistant to Phytophthora capsici, Meloidogyne incognita, and waterlogging in Vietnam

Assessment of nematicidal and plant growth-promoting effects of Burkholderia sp. JB-2 in root-knot nematode-infested soil

Contact Info

Product

Resources

About