Detection of Strawberry necrotic shock virus using conventional and TaqMan® quantitative RT-PCR

Abstract

Graft-indexing of an advanced selection from the University of Florida strawberry breeding program produced virus-like symptoms on Fragaria vesca. However; RT-PCR testing of the material did not detect the presence of any of 16 strawberry virus species or members of virus groups for which strawberries are routinely indexed. Large scale sequencing of the material revealed the presence of an isolate of Strawberry necrotic shock virus. The nucleotide sequence of this isolate from Florida shows a significant number of base changes in the annealing sites of the primers compared to the primers currently in use for the detection of SNSV thereby explaining the most probable reason for the inability to detect the virus in the original screening. RT-PCR and Taqman(®) qPCR assays were developed based on conserved virus sequences identified in this isolate from Florida and other sequences for SNSV currently present in GenBank. The two assays were applied successfully on multiple samples collected from several areas across the United States as well as isolates from around the world. Comparison between the RT-PCR and the qPCR assays revealed that the qPCR assay is at least 100 times more sensitive than conventional PCR.

Population structure, evolution and detection of blackberry leaf mottle‐associated virus, an emerging emaravirus

“…The assay that consistently gave the lowest Cq value was selected for further evaluation. Properties of the selected qPCR assay standard curve were within the recommended qualities described previously (Poudel et al ., ; Thekke‐Veetil et al ., ). The slope (−3.430), the correlation coefficient ( R 2 = 0.992), the average efficiency ( E = 95.7%) and y ‐intercept (43%) showed that this assay could be used to quantify target RNA (Fig.…”

Transmission attributes and resistance to rose rosette virus

“…In the presence of the virus, the smaller 271 bp RRV‐specific PCR product is preferred over the 721 bp NADH internal control. In the absence of virus the assay will amplify the 721 bp region of the cDNA internal control, verifying the enzymatic reactions were successful, whereas when there is RNA degradation a c. 1300 bp region of the genomic copy will be amplified (Thekke‐Veetil et al ., ). Several RRV samples were compared using the Laney et al .…”

“…Primers were optimized for multiplex PCR of the virus and a NADH dehydrogenase internal control, to ensure quality of nucleic acids and efficient amplification. The following primers were used: RRVF (5 0 -GCACATCCAACACTCTTGCAGC-3 0 ) and RRVR (5 0 -CTTATTTGAAGCTGCTCCTTGATTTCC-3 0 ), designed to amplify a 271 bp product in a highly conserved region of RNA 3 (Laney et al, 2011;Katsiani et al, 2017), and NADH ND-2F (5 0 -GGACTCCTGACGTATACGAAGGATC-3 0 ) and NADH ND-2R (5 0 -AGTAGATGCTATCACACATACAAT-3 0 ) that amplify a region of the mRNA or the genomic copy of NADH dehydrogenase ND-2 subunit gene, which contains an intron depending on the quality of the extracted nucleic acids, an important aspect of detection when working with perennial plants (Tzanetakis et al, 2007;Thekke-Veetil et al, 2016). Total nucleic acids were extracted from infected and RRV-free samples, reverse transcribed and amplified essentially as described in Poudel et al (2013).…”

Resistance to Rose Rosette Virus and Transmission Attributes

“…Oligonucleotide primers were optimized for multiplex PCR of virus and an internal control to ensure quality of nucleic acids and efficient amplification. The most efficient amplification was achieved using primers RRVF (5'-GCACATCCAACACTCTTGCAGC-3') and RRVR (5'-CTTATTTGAAGCTGCTCC TTGATTTCC-3'), designed to amplify a 271 bp product in an RNA 3 region with 100% nucleotide identity among sequenced isolates [14; 18] and NADH ND-2F (5' GGACTCCTGACGTATACGAAGGATC3') and NADH ND-2R (5' AGTAGATGCT ATCACACATACAAT 3') that amplify a region of the mRNA or the genomic copy of NADH dehydrogenase ND-2 subunit depending on the quality of the extracted nucleic acids, an important aspect of detection when working with perennial plants [24,25]. Total nucleic acids were extracted from infected and RRV-free samples, reverse transcribed and amplified essentially as described in Poudel et al [23].…”

“…A universal detection protocol based on the population structure of the virus available to date was developed [14]. In addition, this protocol provides the unique advantage of being multiplexed with an internal control confirming the quality of the nucleic acids, as they may be readily affected in all downstream reactions post extraction and also confirming efficiency of PCR amplification, as it will amplify a 721 base region of the internal control in the absence of virus or a ∼1300 bp region of the genomic copy of that gene when there is RNA degradation [24]. We compared several RRV samples using the Laney et al [18] and the new protocol and the latter provided better amplification consistently, able to detect the virus even at 20 PCR cycles (Figure 2).…”