Detection of streptococcus mutans and streptococcus sobrinus in dental plaque samples from Brazilian preschool children by polymerase chain reaction

Franco, Teresa Cristina Costa Franco e; Amoroso, Patrícia; Marin, José Moacir; Ávila, Fernando Antônio de

doi:10.1590/s0103-64402007000400011

Cited by 37 publications

(35 citation statements)

References 15 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The gtfB and gtfI genes of Streptococcus mutans and Streptococcus sobrinus respectively are suitable for designing PCR primers, as both genes express important virulence factors of the cariogenic bacteria and have nucleotide sequences specific to each species [17]. The same set of primers were used for the detection of S. mutans and S. sobrinus in studies done by Carmona et al [8], Seki et al [18] and Franco e Franco et al [19] and they yielded substantial results.…”

Section: Discussionmentioning

confidence: 99%

Distribution of S. mutans and S. sorbinus in Caries Active and Caries Free Children by PCR Approach

Soni¹,

Vasavada²

2015

Int J Oral Craniofac Sci

View full text Add to dashboard Cite

Background: Streptococcus mutans (S. mutans) and Streptococcus sorbinus (S. sorbinus) have been considered to be the most important micro-organisms associated with dental caries. Therefore, purpose of this study is to detect and correlate the presence of S. mutans and S. sobrinus in the dental plaque of caries free and caries active children, by using Polymerase chain reaction (PCR) method. Materials and Methods:Twenty patients aged between ages 4-8 years were included in the study. The subjects were divided in two groups: Group A consisting of ten children with early childhood caries and Group B consisting of ten caries-free children. Dental examinations were performed using a plane dental mirror and explorer. Plaque sample was collected from the cervical margin of the teeth by using explorer. PCR testing was performed for S. mutans and S. sorbinus. The data was analyzed by using SPSS software. The caries score data was analyzed among groups by applying Fischer's exact test. The P value <0.05 was considered as significant.Results: S. mutans was present in all patients, whether they were caries active or caries free. There was no statistically significant difference in the presence of S. sorbinus in caries active patients as compared to caries free patients. It was also noticed that S. sorbinus was found more in male patients as compared to females, the difference being statistically non-significant. Conclusion:Children harbouring both S. mutans and S. sorbinus had a higher incidence of dental caries as compared to the presence of either organism alone.Among the oral bacteria, Mutans streptococci have been implicated as a major cariogenic bacteria. The degree of colonization of these organisms correlates with the prevalence of dental caries in children and experimental animals.Mutans streptococci is divided into seven species: Streptococcus mutans, Streptococcus sobrinus, Streptococcus downei, Streptococcus rattus, Streptococcus cricetus, Streptococcus ferus, and Streptococcus macacae. Among these S. mutans and S. sobrinus are strongly associated with human dental caries [6]. Epidemiological studies have reported that S. mutans is more prevalent than S. sorbinus in the oral cavity, but have also shown that the prevalence of S. sorbinus is more closely associated with a high caries experience [7].Molecular methods for bacterial identification and enumeration now make it more precise to study the microbiota associated with caries. DNA sequence-based assays can be used to identify closely related species that are difficult to differentiate by traditional, culturebased approaches [8]. Various methods have been used for detection, including biochemical tests, immunological tests, DNA probes, and Polymerase Chain Reaction (PCR). Among these, the PCR method is currently being applied to the detection of putative pathogens and the identification of human cariogenic bacteria because it is rapid, sensitive, and simple.The purpose of this study is to detect and correlate the presence of S. mutans and S. sobrinus in...

show abstract

Section: Discussionmentioning

confidence: 99%

Distribution of S. mutans and S. sorbinus in Caries Active and Caries Free Children by PCR Approach

Soni¹,

Vasavada²

2015

Int J Oral Craniofac Sci

View full text Add to dashboard Cite

show abstract

“…The 16S ribosomal RNA gene was used to detect P. nigrescens ( 5 ' AT G A A A C A A A G G T T T T C C G G TA A G 3 ' 5'CCCACGTCTCTGTGGGGCTGCGA3' (804bp)) and P. intermedia (5'TTTGTTGGGGAGTAAAGCGGG3' and 5'TCAACATCTCTGTATCCTGCGT3' (575bp)) according to Tomazinho and Ávila-Campos (18). The target gene to detect S. mutans was the glucosyltransferase-I (5'ACTACACTTTCGGGTGGCTTGG3' and 5'CAGT ATAAGCGCCAGTTTCATC3'(517bp)) according to Franco and Franco et al (19) and the 16S ribosomal RNA gene was used to detect Actinomyces spp 5'CTTAGCTTGCTAAGTATGCCGTTTAG3' and 5'CAGCTGACTTATACTCCCGAAATC3' (889bp) according to Saba et al (7). Positive controls used in each experiment were the genomic DNA of S. mutans, P. nigrescens (ATCC 35406), P. intermedia (ATCC 25611) and Actinomyces spp (B19SC strain).…”

Section: Identification Of the Bacteria By Multiplex Pcrmentioning

confidence: 99%

Biofilms of black tooth stains: PCR analysis reveals presence of Streptococcus mutans

et al. 2012

View full text Add to dashboard Cite

This study investigated the presence of the black-pigmented bacteria Prevotella nigrescens and Prevotella intermedia, the non-black-pigmented bacteria Actinomyces spp and particularly the cariogenic pathogen Streptococcus mutans in the dental biofilms of patients with or without black extrinsic tooth stains, using the multiplex polymerase chain reaction (PCR) technique. Analysis of the dental biofilms of patients with (n=26) or without (n=26) black tooth stains was performed using duplex PCR for the 16S ribosomal RNA gene (P. nigrescens, P. intermedia, Actinomyces spp) and glucosyltransferase-I gene for S. mutans. P. nigrescens and S. mutans were the most frequent bacteria detected in both groups. The least frequently detected were P. intermedia and Actinomyces spp. The similar bacterial composition of dental biofilms of black tooth stains and healthy tooth surfaces indicates that black tooth stains are not free of cariogenic bacteria.

show abstract

“…The PCR reaction was performed in a volume of 25 µl under the following conditions: initial denaturation at 95 °C for 4 min, 30 cycles of denaturation at 95 °C for 30 s, annealing at 59 °C for 30 s and extension at 72 °C for 5 min. PCR-amplified products were then analysed by horizontal electrophoresis using a 1.5% agarose gel (Franco e Franco et al 2007). The primer sequences used in this study are provided in Table 1.…”

Section: Methodsmentioning

confidence: 99%

Antibacterial properties of Carum copticum essential oil against Streptococcus mutans and Streptococcus sobrinus isolated from canine dental plaque

Gharajalar¹,

Hassanzade²

2017

Vet. Med. - Czech

View full text Add to dashboard Cite

Dental caries is amongst the most prevalent oral diseases in both humans and dogs. Streptococcus mutans and Streptococcus sobrinus (mutans streptococci) are the major cariogenic bacteria isolated from dental caries. Since these bacteria generally show resistance to common antibiotics, natural products such as plant essential oils could be a good substitute. For this study, we aimed to evaluate the antibacterial activity of Carum copticum essential oil against Streptococcus mutans and Streptococcus sobrinus. Twenty canine dental plaque samples were collected and the presence of S. mutans and S. sobrinus in the samples was confirmed using biochemical, culture and polymerase chain reaction (PCR) assays. The resistance patterns of isolates were determined using a disc diffusion method according to the Clinical Laboratory Standards Institute protocol against the following antimicrobials: chloramphenicol, tetracycline, penicillin, erythromycin, ceftriaxone, cefotaxime, vancomycin and azithromycin. The antibacterial activities of Carum copticum essential oil were based on the disc diffusion method as well on a determination of the minimum inhibitory (MIC 50 ) and minimum bactericidal concentration values. S. mutans and S. sobrinus were isolated in 8 (40%) and 2 (10%), respectively, of plaque samples. Most of these isolates were determined to display multidrug resistance patterns to the eight antibiotics evaluated. Screening of the antibacterial activity of the essential oil indicated that MIC 50 and minimum bactericidal concentration values were 20 µg/ml and 80 µg/ml, respectively, and that the zone of inhibition in the disc diffusion method ranged from 2 to 5 mm for serial concentrations of the essential oil. Based on our results, we suggest that Carum copticum essential oil exerts antibacterial effects against Streptococcus mutans and Streptococcus sobrinus and may be a useful treatment for carious lesions with bacterial aetiologies.

show abstract

Detection of streptococcus mutans and streptococcus sobrinus in dental plaque samples from Brazilian preschool children by polymerase chain reaction

Cited by 37 publications

References 15 publications

Distribution of S. mutans and S. sorbinus in Caries Active and Caries Free Children by PCR Approach

Distribution of S. mutans and S. sorbinus in Caries Active and Caries Free Children by PCR Approach

Biofilms of black tooth stains: PCR analysis reveals presence of Streptococcus mutans

Antibacterial properties of Carum copticum essential oil against Streptococcus mutans and Streptococcus sobrinus isolated from canine dental plaque

Contact Info

Product

Resources

About