Determination of the IgG2a allotype of CXB recombinant inbred mouse strains by a PCR-based method

Endogenous dendritic cells mediate the effects of intravenously injected therapeutic immunosuppressive dendritic cells in transplantation

“…Because of their low numbers, we estimated semiquantitatively the amount of MR-DCs in the spleen by PCR analysis for the IgG2a a allele, which is encoded in the BALB/c, but not B6, genome. 30 Using serially diluted BALB/c MR-DCs, we determined the sensitivity of the assay to be approximately 1 BALB/c MR-DC in 10 000 B6 splenocytes ( Figure 5B). The content of BALB/c DNA decreased steadily 1 hour after MR-DC inoculation and was barely detectable 24 hours later, approximately indicative of less than or equal to 10 000 BALB/c MR-DCs per spleen ( Figure 5B).…”

“…DNA (DNeasy Tissue Kit, QIAGEN) from spleen of B6 mice injected with BALB/c MR-DCs 24 hours after treatment with (or not) NK1.1 Ab (200 g, intraperitoneally) was used as template for polymerase chain reaction (PCR) using primers for IgG2a a (BALB/c and B6 mice encode for the IgG2a a and IgG2a b alleles, respectively) 30 and the ribosomal S15 housekeeping gene. The primer sequences were: IgG2a a : forward, 5Ј ACAAAGTC-CCTGGTTTGGTGC, and reverse, 5Ј GGCATTTGCATGGAGGACAG (111-bp product); S15: forward, 5Ј TTCCGCAAGTTCACCTACC, and reverse, 5Ј CGGGCCGGCCATGCTTTACG (1231-bp product).…”