Development and Application of an MRT-qPCR Assay for Detecting Coinfection of Six Vertically Transmitted or Immunosuppressive Avian Viruses

Abstract

Marek's disease virus (MDV), reticuloendotheliosis virus (REV), avian reovirus (ARV), chicken infectious anemia virus (CIAV), infectious bursal disease virus (IBDV), and fowl adenovirus (FAdV) are important causes of disease in poultry. To investigate the infection status of the above six viruses in chickens in China, 1,187 samples from chicken flocks were collected and tested using a newly developed multiplex reverse-transcription quantitative real-time PCR (MRT-qPCR) assay in the study. A series of validation tests confirmed that the MRT-qPCR assay has high specificity, sensitivity, and repeatability. As for six detected pathogens, CIAV had the highest detection ratio, while ARV was not detected in any samples. In the spleen samples, the coinfection rate for MDV and CIAV was 1.6%, and that for REV and CIAV was 0.4%. In the bursa samples, the coinfection rate for FAdV and CIAV was 0.3%, and that for IBDV and CIAV was 1%. In the thymus samples, the coinfection rates for MDV and CIAV and for REV and CIAV were both 0.8%. Our study indicates that the coinfection of these viruses was existing in chickens in China. Through the detection of clinical samples, this study provides data on the coinfections of the above six pathogens and provides a basis for the further study of viral coinfection in chickens.

Experimental co-infection of variant infectious bursal disease virus and fowl adenovirus serotype 4 increases mortality and reduces immune response in chickens

“…The obtained DNA was used to quantify the viral load by RT-qPCR. Primers were designed based on conserved regions of the FAdV genome using Primer Premier 5.0 (N-F: 5′AAAACTGAGACTTTCCCACAA 3′; N-R: 5′AGATACCCTCCGAAGAACTAC 3′), as described by Li et al [ 17 ]. All samples were tested in triplicate, and assays were repeated at least twice.…”

Molecular Epidemiology and Pathogenic Characterization of Novel Chicken Infectious Anemia Viruses in Henan Province of China

“…Interestingly, co-infection of four immunosuppressive pathogens including CIAV has been detected in Shandong Province ( 17 , 18 ). Recently, 1,187 clinical samples from major poultry farms nationwide from 2017 to 2020, have been tested for co-infection with six immunosuppressive pathogens including CIAV ( 19 ). These surveys have confirmed the widespread nature of CIAV in China, which has seriously affected the development of the poultry industry.…”

The Diagnosis and Molecular Epidemiology Investigation of Avian Hepatitis E in Shandong Province, China

“…In the current study, further PCR detection showed that all 11 HEV positive samples were mixed infections, of which the infection rates of HEV and CIAV, HEV and FAdV were highest. CIAV is an important immunosuppressive virus in chicken, and according to the epidemiology investigation of co-infection of vertically transmitted or immunosuppressive viruses in chickens by Li et al, CIAV had the highest detection ratio [15]. FAdV has been prevalent in poultry in recent years and caused huge economic losses to poultry industry in China [16,17].…”