Development and validation of rt-qpcr for vesicular stomatitis virus detection (Alagoas vesiculovirus)

Oliveira, Anapolino Macedo de; Júnior, Antônio Augusto Fonseca; Camargos, Marcelo Fernandes; Orzil, Lívia de Lima; Laguardia-Nascimento, Mateus; Oliveira, Anna Gabriella Guimarães; Rodrigues, Jacqueline Gomes; Sales, Mariana Lázaro; Oliveira, Tatiana Flávia Pinheiro de; Melo, Cristiano Barros de

doi:10.1016/j.jviromet.2018.03.011

Cited by 13 publications

(5 citation statements)

References 24 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The relevance of this finding is further increased by the fact that infection by this strain of VS virus has only been diagnosed in the State of São Paulo (Pauszek et al, 2011), emphasizing the importance of epidemiological surveillance during the importation of animals from other states. Moreover, VS virus can occasionally affect humans and could be transmitted to other species of domestic and wild animals (Oliveira et al, 2018).…”

Section: Resultsmentioning

confidence: 99%

Seroprevalence of viral agents in vaquejada horses

et al. 2018

View full text Add to dashboard Cite

In order to investigate the prevalence of viral diseases in vaquejada horses, samples were collected from Quarter Horse and Paint Horse breeds (males and females, aged between 2 and 15 years) from rural and urban areas of Mossoró, Rio Grande do Norte, Brazil were collected. The number of samples collected and tested varied with the techniques used: 132 serum samples were tested for vesicular stomatitis (VS) and equine viral arteritis (EVA), 118 for western and eastern equine encephalomyelitis (WEE/EEE), 114 for equine herpesvirus 1 (EHV-1), and 61 for equine influenza (EI). The techniques used varied according to the disease studied: tests for VS (Ribeirão and Alagoas strains), EVA, EHV-1, and WEE/EEE were performed using the seroneutralization technique in Vero cell cultures, while the test for for EI type-2 (H3N8) was performed using the hemagglutination inhibition technique. The following results were obtained: 39 (29.55%) and 6 (4.54%) VS-positive horses (n=132) harbored the Alagoas and Ribeirão strains, respectively; no animal tested positive for EVA (n=132); 11.01% (n=13) and 0.84% (n=1) animals tested positive for EEE and WEE (total n=118), respectively; and 22 out of 114 (19.29%) horses tested positive for EHV-1. The history of respiratory and reproductive diseases was statistically significantly (p = 0.02) related to the presence of antibodies against EHV-1. This is the first report of the seroprevalence of viral diseases in vaquejada horses in Rio Grande do Norte.

show abstract

Section: Resultsmentioning

confidence: 99%

Seroprevalence of viral agents in vaquejada horses

et al. 2018

View full text Add to dashboard Cite

show abstract

“…Due to genetic diversity among VSAVs, a pair of primers and a probe were used for each viral isolate. Oligonucleotides VSAV.GP.78 and VSAV.GP.95, described [ 14 ] by De Oliveira et al (2018), were used for the amplification of VSAV Alagoas and VSAV Custodia, respectively. For VSAV Agulhas Negras, the following oligonucleotides were designed: VSAV.PPP.77.F: 5′AGGATGAAGATGTGGAAGTGG3′ (272-292 position GenBank Accession Number JF795529.1) and VSAV.PPP.77.R: 5′AGATTTGCCAGTCGAGTCTG3′ (348–329) and the probe VSAV.PPP.77.S FAM-5′CGTTTACCTCAGAATGGAAGCTCCCG3′-Iowa Black.…”

Section: Methodsmentioning

confidence: 99%

“…BHK-21 and Vero cells were not used for confirmation. The amplification process was performed by RT-qPCR on the CFX96 Touch Real-Time Detection System (Bio-Rad, USA), following the amplification proposed [ 14 ] by De Oliveira et al (2018).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Quantification of in vitro replication kinetics of Alagoas vesiculovirus isolates by digital droplet RT-PCR

et al. 2023

Self Cite

View full text Add to dashboard Cite

Vesicular stomatitis caused by Alagoas vesiculovirus (VSAV) has generated disease outbreaks in Brazil, mainly in the northeast region. Phylogenetic studies divide the isolates into three distinct genotypes (A, B, and C). However, there is no description of how this genetic divergence reflects on the phenotype of VSAV isolates such as in vitro replication fitness. Therefore, the objective of this work was to evaluate the ability of three distinct genotypes of Brazilian isolates of VSAV to grow in different cell-culture lines (BHK-21, Vero, and NCI-H1299). Quantification of viral RNA was performed using RT-PCR digital droplet from supernatant of cell culture collected every 4 h for a period of 24 h of viral growth in three different cell lines (BHK-21, Vero, and NCI-H1299). It was observed that the genotype C isolate has the lowest replication efficiency among the three analyzed viruses, without major changes in the copies of viral RNA over the entire time of the study.

show abstract

“…Brazil, in a broader way, considering the OVS, has been investing in training, data analysis and staff training with a scientific basis, including themes related to the inspection of products of animal origin (Rodrigues et al, 2017(Rodrigues et al, , 2018(Rodrigues et al, , 2021, international agricultural surveillance (Melo et al, 2014a(Melo et al, , 2014b(Melo et al, , 2015Sá et al, 2018), agricultural defence (Moraes et al, 2017;Oliveira et al, 2021) and diagnosis and official laboratory structure (Dias et al, 2014;Oliveira et al, 2018Oliveira et al, , 2021. This shows that the country has been preparing for the new sanitary challenges in livestock and in this sense, the DF continues to adapt to international requirements, as demonstrated in this paper, especially considering the stage Brazil is at in the National Programme for the Eradication of FMD, in which the intention is to gradually remove vaccination against FMD from cattle and buffalo herds in Brazilian states, in accordance with the proposal approved by the OIE (Brasil, 2019).…”

Section: /11mentioning

confidence: 99%

Challenges to and advancements of the official veterinary service of the Federal District, Brazil

Taques¹,

Coelho

Barbosa-Júnior

et al. 2021

Braz. J. Vet. Med.

View full text Add to dashboard Cite

Animal diseases can be both a precursor to social instability and a result of social instability. For disease outbreaks to be prevented or even quickly controlled, an efficient and well-structured veterinary service is fundamental. The monitoring of the efficiency of an official veterinary service (OVS) by official audits is a sine qua non condition for the progress of an efficient way to control and eradicate diseases. In this sense, the present work aims to study the advances and challenges of the OVS of the Federal District (DF), Brazil, from a study of the scores obtained by the evaluation of the Programme of Quality Evaluation and Improvement of Official Veterinary Services which is based on the World Organisation for Animal Health -Performance of Veterinary Services Pathway (Quali-SV/OIE-PVS), which was used to officially assess the quality and improvement of the OVS of the DF. In Brazil, the official evaluation was conducted by the Coordination of Evaluation and Improvement of Veterinary Services, Ministry of Agriculture, Livestock and Food Supply, considering manpower, infrastructure and financial resources. Five possible scoring levels were audited: authority, technical and operational capacity, interaction with stakeholders and access to markets. These components were described and assessed as critical competencies in the OVS assessment. Strengths and weaknesses observed during the audit were listed, and levels of OVS progress were rated and assessed. Despite the predominance of strengths in the OVS audit, the weaknesses detected require urgent corrective action, especially with regard to the autonomy of the OVS.

show abstract

Development and validation of rt-qpcr for vesicular stomatitis virus detection (Alagoas vesiculovirus)

Cited by 13 publications

References 24 publications

Seroprevalence of viral agents in vaquejada horses

Seroprevalence of viral agents in vaquejada horses

Quantification of in vitro replication kinetics of Alagoas vesiculovirus isolates by digital droplet RT-PCR

Challenges to and advancements of the official veterinary service of the Federal District, Brazil

Contact Info

Product

Resources

About