Development and validation of SYBR Green- and probe-based reverse-transcription real-time PCR assays for detection of the S and M segments of Schmallenberg virus

Azkur, Ahmet Kürşat; Poel, Wim van der; Aksoy, Emel; Honing, Renate Hakze-van der; Yıldırım, Murat; Yıldız, Kader

doi:10.1177/1040638720947199

Cited by 4 publications

(4 citation statements)

References 18 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Such variation is, however, likely due to within animal tissue specificity/tropism and mutation; it is not reflected in circulating viruses where selection pressure to maintain transmissibility in multiple mammalian and insect hosts is high 36 . The performance for the S segment in the assay compared with the M gene assays was similar 35 . Consequently, it seems unlikely that qPCR assay mismatches were responsible for the failure to detect SBV in ram semen.…”

Section: Discussionmentioning

confidence: 98%

“… 36 The performance for the S segment in the assay compared with the M gene assays was similar. 35 Consequently, it seems unlikely that qPCR assay mismatches were responsible for the failure to detect SBV in ram semen.…”

Section: Discussionmentioning

confidence: 99%

“…However, there does not appear to have been significant variation in the S gene sequence (which the qPCR assay used here targets) that would have resulted in assay failure at this time; indeed, the virus seems remarkably stable and we used the same assay to detect SBV viraemia in sheep in 2016 6,31 . Alternative assays have been proposed to detect the virus (particularly in the M segment), 35 which is where the major hypervariable region in SBV is reported. Such variation is, however, likely due to within animal tissue specificity/tropism and mutation; it is not reflected in circulating viruses where selection pressure to maintain transmissibility in multiple mammalian and insect hosts is high 36 .…”

Section: Discussionmentioning

confidence: 99%

See 2 more Smart Citations

Failure to detect Schmallenberg virus RNA in ram semen in the UK (2016–2018)

Curwen,

Jones,

Stayley

et al. 2022

Veterinary Record Open

View full text Add to dashboard Cite

Background Schmallenberg virus (SBV) is a midge‐borne arbovirus that first emerged in the European ruminant population in 2011 and has since settled to an endemic pattern of disease outbreaks on an approximately 4‐year cycle when herd immunity from the previous circulation drops to a point allowing renewed widescale virus circulation. The impacts of trade restrictions on genetic products (semen, embryos) from affected areas were severe, particularly after the discovery that the virus is intermittently shed in the semen of a small number of bulls. The trade in small ruminant (ram and goat) semen is less than that of bulls; nonetheless, there has been no study into the shedding rate of SBV in ram semen. Methods Semen samples ( n = 65) were collected as part of UK ram trials and artificial insemination studies around the period of the 2016–2018 SBV recirculation. Semen was preserved in RNA later for shipping, and RNA extraction with RNeasy and S gene RT‐quantitative PCR performed for SBV nucleic acid detection. Results No SBV RNA was detected in any samples. Conclusions While larger numbers of animals would be needed to completely exclude the possibility of SBV shedding in ram semen, this trial nonetheless highlights that this is likely a rare event if it occurs at all and is unlikely to play a role in disease transmission.

show abstract

Section: Discussionmentioning

confidence: 98%

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Failure to detect Schmallenberg virus RNA in ram semen in the UK (2016–2018)

Curwen,

Jones,

Stayley

et al. 2022

Veterinary Record Open

View full text Add to dashboard Cite

show abstract

“…All the RNA samples were retrotranscribed using a commercial kit (iScript™ cDNA Synthesis Kit, BioRad). For the reaction mix (20 µL), 2 µL of template, 2× SYBR Green I master mix, and a final concentration of 500 nM of each primer (forward primer 5’ CAGGATGTCAGGATATCTAG 3’ and reverse primer 5’ TCCCTTAACCTCAGCAA 3’) were used [ 52 ]. A reference strain was used as positive control (SBV-BH80/11–4).…”

Section: Methodsmentioning

confidence: 99%

First evidence of schmallenberg virus infection in southern Italy

et al. 2023

View full text Add to dashboard Cite

Background Schmallenberg virus (SBV) is a vector-borne pathogen that mainly affects ruminants. Schmallenberg disease has never been described in southern Italy, although this geographic area displays climatic features suitable for Culicoides biting midges, which transmit the pathogen. An observational study was carried out in the Campania region in 2020 to evaluate the seroprevalence in cattle and water buffalo as well as to identify the risk factors involved in the distribution of SBV. Results Relatively high seroprevalences of 38.2% (cattle) and 43% (water buffalo) were found by using a commercial SBV ELISA, which is comparable to the prevalence obtained in other countries under post-epidemic conditions. A virus neutralization assay performed on positive samples showed high titers in a large percentage of animals which is assumed to indicate recent exposure. Bivariate analysis of several variables revealed some environmental factors associated with higher seroprevalence, such as mean annual temperature, distance from the coast, and altitude. Multivariate logistic regression confirmed the statistical association only for mean annual temperature, that was found to be the main factor responsible for the distribution of the virus in southern Italy. In addition, molecular diagnosis attempts were performed on serum samples and resulted in the detection of SBV RNA in two herds and six animals. Conclusions In this work we have demonstrated the circulation of SBV in southern Italy using both molecular and serological assays. This study emphasized the essential role of monitoring in preventing the re-emergence of vector-borne diseases in ruminants.

show abstract

Detection of Epstein-Barr Virus Genome in Pediatric Patients With Leukemia and Hodgkin Lymphoma: Viral Etiology in Pediatric Cancers in Türki̇ye

KÖKSAL,

AZKUR,

AKSOY

et al. 2023

Kırıkkale Üniversitesi Tıp Fakültesi Dergisi

Self Cite

View full text Add to dashboard Cite

Objective: Cancer is a pervasive disease characterized by its widespread occurrence and challenging treatment process. While numerous agents, including viruses, have been identified as potential causes of cancer in both adults and children, the complete pathogenesis of cancers remains incompletely elucidated. This study aimed to examine the presence of four viral agents, namely Human T-cell Lymphotropic Virus Type 1 (HTLV-1), Epstein-Barr Virus (EBV), Kaposi's Sarcoma- Associated Herpesvirus (KSHV), and Human Parvovirus B19 (HPV B19), in blood samples obtained from pediatric patients (n=64) diagnosed with B cell acute lymphoblastic leukemia (ALL), T cell ALL, Hodgkin lymphoma, and patients with relapsed leukemia and lymphoma. Material and Methods: The whole blood samples collected from the patients during the pre-treatment and post-treatment periods underwent polymerase chain reaction (PCR) and real- time PCR to identify the presence of the viral genomes of HTLV-1, EBV, KSHV, and HPV B19. The samples that tested positive were subsequently subjected to Sanger sequencing, followed by phylogenetic analysis. Results: Among a total of 64 samples analyzed, HTLV-1, KSHV, and HPV B19 were found to be negative. However, EBV genome was detected in six samples (9.37%) from patients with ALL and Hodgkin lymphoma, comprising both pre- treatment (n=3) and post-treatment (n=3) cases. Subsequent sequencing and alignment of the positive EBV samples with other EBV sequences deposited in GenBank revealed a high degree of similarity. Conclusion: Our findings suggest that EBV may be one of the viral agents implicated in pediatric cancer cases involving leukemia and Hodgkin lymphoma. Therefore, it is recommended to consider testing for the presence of EBV genome in these patient populations within the context of Türkiye. This information contributes to a better understanding of the viral etiology underlying pediatric cancers, enabling the development of targeted diagnostic and therapeutic strategies in the future.

show abstract

Development and validation of SYBR Green- and probe-based reverse-transcription real-time PCR assays for detection of the S and M segments of Schmallenberg virus

Cited by 4 publications

References 18 publications

Failure to detect Schmallenberg virus RNA in ram semen in the UK (2016–2018)

Failure to detect Schmallenberg virus RNA in ram semen in the UK (2016–2018)

First evidence of schmallenberg virus infection in southern Italy

Detection of Epstein-Barr Virus Genome in Pediatric Patients With Leukemia and Hodgkin Lymphoma: Viral Etiology in Pediatric Cancers in Türki̇ye

Contact Info

Product

Resources

About