Development of a duplex semi-nested PCR assay for detection of classical goose parvovirus and novel goose parvovirus-related virus in sick or dead ducks with short beak and dwarfism syndrome

Li, Pengfei; Zhang, Ruihua; Chen, Junhao; Sun, Dianjianyi; Lan, Jingjing; Lin, Shaoli; Song, Shasha; Xie, Zhixun; Jiang, Shijin

doi:10.1016/j.jviromet.2017.09.011

Cited by 17 publications

(17 citation statements)

References 20 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The primers were as follows: NGPV‐1F (5′‐AGA CTT ATC AACAAC CAT (C)T‐3′, position 3278–3296) and NGPV‐1R (5′‐TCA CTT ATT CCT GCT GTA G‐3′, position 4038–4056) were designed to amplify a 779‐base pair (bp) fragment, NGPV‐2R (5′‐CAT CAT CCG TAA AAA CTT GG‐3′, position 3406–3425) was designed with NGPV‐1F to amplify a 147 bp fragment. The seminested PCR assay was performed as our previous work (Li, Lin et al., ; Li, Zhang et al., ).…”

Section: Methodsmentioning

confidence: 99%

Duck “beak atrophy and dwarfism syndrome” disease complex: Interplay of novel goose parvovirus-related virus and duck circovirus?

J.)

Zhang

et al. 2018

Transbound Emerg Dis

View full text Add to dashboard Cite

As a newly emerged infectious disease, duck "beak atrophy and dwarfism syndrome (BADS)" disease has caused huge economic losses to waterfowl industry in China since 2015. Novel goose parvovirus-related virus (NGPV) is believed the main pathogen of BADS disease; however, BADS is rarely reproduced by infecting ducks with NGPV alone. As avian circovirus infection causes clinical symptoms similar to BADS, duck circovirus (DuCV) is suspected the minor pathogen of BADS disease. In this study, an investigation was carried out to determine the coinfection of NGPV and DuCV in duck embryos and in ducks with BADS disease. According to our study, the coinfection of emerging NGPV and DuCV was prevalent in East China (Shandong, Jiangsu and Anhui province) and could be vertical transmitted, indicating their cooperative roles in duck BADS disease.

show abstract

Section: Methodsmentioning

confidence: 99%

Duck “beak atrophy and dwarfism syndrome” disease complex: Interplay of novel goose parvovirus-related virus and duck circovirus?

J.)

Zhang

et al. 2018

Transbound Emerg Dis

View full text Add to dashboard Cite

show abstract

“…AvAstV-F1 GAYTGGACNMGNTAYGAYGGNACNATNCC ORF1b gene of AvAstV (434 bp) (Todd et al, 2009) AvAstV-R1 YTTNACCCACATNCCRAA AvAstV-F2 TGGTGGTGYTTYCTCAARA ORF1b gene of AvAstV (601 bp) (Yang et al, 2018) AvAstV-R2 GYCKGTCATCMCCRTARCA GPV-F AGACTTATCAACAACCATCA(T/C) T VP1 gene of GPV (779 bp) (Li et al, 2017) GPV-F TCACTTATTCCTGCTGTAG REOV-F GGTGCGACTGCTGTATTTGGTAAC S1 gene of REOV (513 bp) (Niu et al, 2017) REOV-R AATGGAACGATAGCGTGTGGG GHPV-F GAGGTTGTTGGAGTGACCACAATG VP1 gene of GHPV (144 bp) (Gerin et al, 2000) GHPV-R ACAACCCTGCAATTCCAAGGGTTC TMUV-F GCCACGGAATTAGCGGTTGT E gene of TMUV (401 bp) (Su et al, 2011) TMUV-R TAATCCTCCATCTCAGCGGTGTAG Phylogenetic analysis was performed using the neighbour-joining method in MEGA 6.0 with a P-distance model of amino acids and complete nucleotide sequence substitution and 1,000 bootstrap replicates (Tamura et al, 2013). Genetic distances of amino acid sequences were implemented using the P-distance method in MEGA 6.0 with the pairwise deletion option and 1,000 bootstrap replicates.…”

Section: Primer Name Sequence (5′-3′) Target Referencementioning

confidence: 99%

Characterization and genomic analysis of emerging astroviruses causing fatal gout in goslings

Chen

et al. 2019

Transbound Emerg Dis

View full text Add to dashboard Cite

Since February 2017, severe outbreaks of fatal gout caused by novel gosling astroviruses (GoAstVs) have occurred in several Chinese provinces, causing a considerable economic impact on the poultry industry. To assess the infection status of GoAstVs causing gout, 165 clinical samples were collected from goslings from seven farms located in different Chinese provinces, and they were screened for viral infection. Seven GoAstV strains were completely sequenced. The positive infection rates of GoAstV, goose parvovirus, reovirus, goose haemorrhagic polyomavirus and Tembusu virus were 100%, 9.69%, 3.64%, 0% and 0%, respectively, indicating the role of GoAstV in gout. The genomes of all seven GoAstV strains were 7170‐nt long and encoded three open reading frames (ORFs), namely, ORF1a, ORF1b and ORF2. Sequence and phylogenetic analyses of the seven GoAstV strains showed that these were avastroviruses and were closely related to viruses classified within Avastrovirus 3 and turkey astrovirus 2. Moreover, the mutation rates of ORF1a and ORF2 were high, and ORF1a was highly mutated at amino acid loci 545–580. The tertiary structure of the mutated ORF2 protein was smooth, and its antigenic epitope was highly mutated, which may be related to the pathogenicity of the virus and caused by antibody pressure from the host. These findings enrich our understanding of the evolution of novel GoAstVs causing gout and their circulation as well as lay the foundation for the selection of vaccine strains.

show abstract

“…Since 2015, beak atrophy and dwarfism syndrome ( BADS ) had a sudden outbreak in Cherry Valley duck flocks, leading to severe economic losses to waterfowl industry in China ( Chen et al., 2015 , 2016 ; Li et al., 2016 , 2017 ; Wang et al., 2016 ). A novel goose parvovirus ( GPV )–related virus ( NGPV ) was identified as the causative agent of BADS ( Chen et al., 2015 , 2016 ).…”

Section: Introductionmentioning

confidence: 99%

Coinfection of novel goose parvovirus–associated virus and duck circovirus in feather sacs of Cherry Valley ducks with feather shedding syndrome

et al. 2020

Self Cite

View full text Add to dashboard Cite

Since 2017, an infectious disease, named feather shedding syndrome ( FSS ), has consistently broken out in Cherry Valley ducks in East China. The sick ducks showed the new clinical symptoms of feather shedding and being plucked off with difficulty after slaughter. The high incidence rate of 20 to 70% predominantly happened in ducks of 4 to 5 wk of age, and nearly 40% mortality rate was observed in infected ducks. To explore the possible role of novel goose parvovirus–associated virus ( NGPV ) and duck circovirus ( DuCV ) in this disease, a total of 540 feather sac samples were collected from sick ducks with FSS. The infection rates of NGPV and DuCV in samples were 82.78 and 78.89%, respectively, and the coinfection rate of the 2 viruses was 70.00%. Notably, ducks of 4 to 5 wk of age usually presented obvious and severe FSS in the flocks with high codetection rate of NGPV and DuCV. Furthermore, 9 NGPV strains were isolated from feather sacs and 5 synchronous amino acid mutations were demonstrated in VP3 protein. These results indicated that coinfection of NGPV and DuCV might play an important role in duck FSS disease.

show abstract

Development of a duplex semi-nested PCR assay for detection of classical goose parvovirus and novel goose parvovirus-related virus in sick or dead ducks with short beak and dwarfism syndrome

Cited by 17 publications

References 20 publications

Duck “beak atrophy and dwarfism syndrome” disease complex: Interplay of novel goose parvovirus-related virus and duck circovirus?

Duck “beak atrophy and dwarfism syndrome” disease complex: Interplay of novel goose parvovirus-related virus and duck circovirus?

Characterization and genomic analysis of emerging astroviruses causing fatal gout in goslings

Coinfection of novel goose parvovirus–associated virus and duck circovirus in feather sacs of Cherry Valley ducks with feather shedding syndrome

Contact Info

Product

Resources

About