Development of a quantitative PCR (TaqMan) assay for relative mitochondrial DNA copy number and the common mitochondrial DNA deletion in the rat

Abstract

Changes in mitochondrial DNA copy number and increases in mitochondrial DNA mutations, especially deletions, have been associated with exposure to mutagens and with aging. Common deletions that are the result of recombination between direct repeats in human and rat (4,977 and 4,834, bp, respectively) are known to increase in tissues of aged individuals. Previous studies have used long-distance PCR and Southern blot or quantitative PCR to determine the frequency of deleted mitochondrial DNA. A quantitative PCR (TaqMan) assay was developed to detect both mitochondrial DNA copy number and deletion frequency in the rat. This methodology allows not only the determination of changes in the amount of mitochondrial DNA deletion relative to total mitochondrial DNA but also to determine changes in total mitochondrial DNA relative to genomic DNA. As a validation of the assay in rat liver, the frequency of the common 4,834 bp deletion is shown to increase with age, while the relative mitochondrial DNA copy number rises at a young age (3-60 days), then decreases and holds fairly steady to 2 years of age.

Quantitative analysis of mitochondrial DNA 4977-bp deletion in sporadic breast cancer and benign breast diseases

“…Long range PCR, primer-shift PCR and semi-quantitative PCR are time-consuming and the results are sometimes not reproducible (18)(19)(20). Furthermore, these PCR methods use an endpoint determination that may not be truly quantitative because of plateau effects (21). There have been some reports demonstrating the advantages of using the real-time PCR method and its potential clinical value for the mtDNA 4977 mutation (8,(18)(19)(20)22).…”

In vitro–matured rat oocytes have low mitochondrial deoxyribonucleic acid and adenosine triphosphate contents and have abnormal mitochondrial redistribution

“…The final reaction volume was 20 mL, containing 1Â TaqMan Universal mix (Applied Biosystems Corp, Foster City, CA), 200 nM each of the mitochondrial forward and reverse primers, 100 nM each of the D-loop forward primer (GGTTCTTACTTCAGGGCCATCA) and reverse primer (GATTAGACCCGTTACCATCGAGAT), 100 nM each of the mitochondrial probe (probe 6FAM-TTGGTTCATCGTC CATACGTTCCCCTTA-TAMRA) (18), and 4 mL of the extracted DNA or 4 mL of standard mitochondrial DNA with known copy number. The cycling conditions included an initial phase of 2 minutes at 50 C, followed by 10 minutes at 95 C and 40 cycles of 15 seconds at 95 C and 1 minute at 60 C. Each sample was measured in duplicate.…”

High-fat diet induces emergence of brown-like adipocytes in white adipose tissue of spontaneously hypertensive rats

“…Copy number of mtDNA was assessed with quantitative PCR (qPCR) and expressed as the ratio of mtDNA to nuclear DNA, which is thought to reflect the tissue concentration of the mtDNA per cell. 38 To quantify mtDNA, we amplified fragments from two mitochondrial genes, cytochrome b (Cytb) and cytochrome c oxidase, subunit I (Cox1). To quantify nuclear DNA, we amplified a fragment from the nuclear 18S ribosomal RNA gene (18S).…”