Development of a Real-time PCR assay for Pneumocystis jirovecii on the Luminex ARIES® Platform

Abstract

Pneumocystis pneumonia (PCP) is an opportunistic infection caused by the fungus Pneumocystis jirovecii. Infection with P. jirovecii can result in serious illness in patients with a weakened immune system, and can lead to death if it is not properly diagnosed and treated. Direct detection of P. jirovecii in lower respiratory tract specimens such as bronchoalveolar lavage (BAL) is preferred for rapid diagnosis, a laboratory service currently not available locally. We report here the development of a diagnostic real-time Polymerase Chain Reaction (PCR) assay using BAL specimens to detect P. jirovecii. By targeting the multi-copy mitochondrial large subunit ribosomal RNA gene (mtLSU rRNA) of P. jirovecii, assay sensitivity is increased. Primer pairs were designed to include a fluorescent reporter dye-labeled primer with a unique MultiCode® base pair isoC on the 5'end and one unlabeled primer. The performance characteristics were determined on the Luminex ARIES® instrument, combining DNA extraction, amplification and detection into a one-step process. The cassette contains the reagents needed to perform all of the steps including extraction, purification, amplification, and detection, plus a sample processing control. Accuracy, precision, sensitivity, specificity and stability studies were conducted to validate the assay to meet CLIA requirements. The analytical sensitivity was 89.1%, and the analytical specificity was 100%. The assay could reliably detect 200 organisms/ mL, crossing thresholds (Ct) and melt temperatures (Tm) were consistent, and no cross-reactivity was observed with other pathogens known to cause respiratory infections. The results demonstrated that these primers are specific to Pneumocystis jirovecii. The real-time PCR method using the ARIES® system allowed for rapid and sensitive detection of Pneumocystis pneumonia infections with P. jirovecii using clinical respiratory specimens.

Development and Evaluation of a Fully Automated Molecular Assay Targeting the Mitochondrial Small Subunit rRNA Gene for the Detection of Pneumocystis jirovecii in Bronchoalveolar Lavage Fluid Specimens

“…As a result, an E. coliebased Pneumocystis mtSSU run control was generated by transforming mtSSU plasmids into competent E. coli cells, which can go through all the of the Pneumocystis mtSSU ARIES PCR assay. Considering variation in BALF quality and viscosity, as well as the rigid and thick Pneumocystis cell walls rendering DNA extraction difficult, 3,16,28 pretreatment steps, including bead beating and proteinase K digestion, were added to sample processing. BALF specimens were spiked with the Pneumocystis run controls (mtSSU gene containing E. coli) and then tested with and without pretreatment steps.…”

“…These findings suggested that targeting mtSSU rather than mtLSU may increase the sensitivity of detection of P. jirovecii, which has been suggested by other investigators as well. 18,30 Furthermore, the mtSSU target region of the ARIES PCR assay had a higher melting temperature (80.1 C) than mtLSU (78.2 C), 16 which enabled us to set up a higher and wider melting temperature window for mtSSU (78.8 C to 82.5 C), thereby avoiding non-specific amplification and contributing to a higher specificity. 16,31e33 In the clinical evaluation, the mtSSU ARIES PCR assay demonstrated a specificity of 94.6% (139/147) in detecting P. jirovecii, which is close to the top range of specificity (82.7% to 95.5%) reported from numerous validation studies of P. jirovecii nucleic acid amplification tests.…”

“…MultiCode real-time PCR primers for mtLSU included unlabeled forward primer PCW3A-for (5 0 -CAGACTATGT GCGATAAG GTAGATAGTCG-3 0 ) and FAM/isoC-labeled reverse primer PCW4-rev (5'-/56-FAM/iMe-isodC/GGAG CTTTAATTACTGTTCTGGGC-3 0 ). 14,16 The primers for mtSSU included FAM/isoC-labeled forward primer Pj1098F (5'-/56-FAM/iMe-isodC/TCATGACCCTTATGAAGTGGG C-3 0 ) and unlabeled reverse primer Pj1173R (5 0 -GCTCCG ACTTCCATCATTGC-3 0 ). 18 The optimized thermal cycling conditions were as follows: 50 C for 7 minutes; 95 C for 2 minutes; and 95 C for 5 seconds, 62 C for 7 seconds, and 72 C for 14 seconds, 45 cycles.…”

“…The other set was shipped on dry ice to the Division of Infectious Diseases, University of Louisville, to be tested by the in-house developed Pneumocystis mtLSU ARIES PCR assay (S.M. ), 16 which used the same sample pretreatment and extraction protocol as that for the mtSSU ARIES PCR assay, except for an additional proteinase K digestion step added to the sample pretreatment step for the mtSSU ARIES PCR assay.…”

Triplex Hybridization-Based Nanosystem for the Rapid Screening of Pneumocystis Pneumonia in Clinical Samples

“…250 pM to 1 nM. However, our system is faster, simpler, and requires no especial equipment or trained personnel [ 38 , 39 , 40 , 41 , 42 , 43 ].…”