Development of defined and minimal media for the growth of Bacillus stearothermophilus

Rowe, John J.; Goldberg, Israel; Amelunxen, Remi E.

doi:10.1128/jb.124.1.279-284.1975

Cited by 44 publications

(19 citation statements)

References 3 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Organisms and culture conditions. The effect of temperature on the specific growth rate for B. stearothermophilus ATCC 12980 was determined in the defined medium described by Rowe et al (1975) supplemented with 20 mM Hepes, pH 7.4. An Arrhenius plot of the data exhibited a linear relationship between 47°C and 60°C with an optimal temperature of 60°C.…”

Section: Methodsmentioning

confidence: 99%

Cloning and Characterization of the Arginine‐Specific Carbamoyl‐Phosphate Synthetase from Bacillus stearothermophilus

Yang

Park

Nolan

et al. 1997

European Journal of Biochemistry

View full text Add to dashboard Cite

Bacillus stearothermophilus contains two carbamoyl-phosphate synthetases (CPS), one specific for pyrimidine biosynthesis and the other for arginine biosynthesis. The pyrimidine-specific CPS is repressed by exogenous pyrimidines, and its activity is inhibited by UMP and activated by 5-phospho-a-~-ribosyI diphosphate. The arginine-specific CPS is similarly repressed by exogenous arginine but its activity is not sensitive to these or other potential effectors. Each of the two enzymes consist of two unequal subunits, as is the case for other microbial CPS ; however, the large subunit for the arginine-specific CPS is smaller than that for the pyrimidine-specific enzyme. Comparison of the derived amino acid sequence for the cloned large subunit of the arginine-specific CPS with those for subunits from pyrimidine-sensitive CPS showed significant similarity throughout the polypeptides except at the carboxy terminus, which was identified by other laboratories to contain the binding site for the pyrimidine effector. Unlike the results previously reported for CPS from an enteric mesophile, the kinetic properties of the arginine-specific CPS were not affected by growth of B. stearothermophilus at temperatures near the minimal growth temperature. Furthermore, calorimetric studies showed that the thermal stability of cloned CPS was identical regardless of the growth temperature of B. stearothermophilus between 42°C and 63°C. The thermal stability of cloned CPS was not affected by expression at 37OC in Bacillus subtilis or Escherichia coli. In contrast, the thermal stabilities for CPS and other proteins were higher in extracts of cells grown at higher temperatures. These results indicate that cellular factors, probably chaperonins, are necessary for thermal stability of proteins at and below the optimal temperature for this thermophile.Keywords: thermal stability ; growth temperature; carbamoylphosphate synthetase; kinetics.Carbamoyl-phosphate synthetase (CPS) catalyzes the synthesis of carbamoyl phosphate from ATP, bicarbonate and either ammonia or glutamine. Bacterial CPS consist of two unequal subunits ; the large subunit alone catalyzes the synthesis of carbamoyl phosphate from MgATP, bicarbonate and ammonia; the small subunit functions as a glutamine amidotransferase (Glansdorff, 1996). In gram-negative bacteria, a single CPS catalyzes the synthesis of carbamoyl phosphate as a precursor for arginine and pyrimidines (Glansdorff, 1996). In contrast, studies with Bacillus subtilis showed that this gram-positive bacterium possesses two CPS, each specific for arginine or pyrimidine biosynthesis and each under separate control (Paulus and Switzer, 1979). The nucleotide sequences for the two CPS from B. subtilis have been determined (Quinn et al., 1991;O'Reilly and Devine, 1994) and limited studies with partially purified enzymes have been reported (Paulus and Switzer, 1979 Enzymes. Carbamoyl-phosphate synthetase (glutaniine-hydrolyzing) (EC 6.3.5.5); glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) (EC 1.2.1.12).Note....

show abstract

Section: Methodsmentioning

confidence: 99%

Cloning and Characterization of the Arginine‐Specific Carbamoyl‐Phosphate Synthetase from Bacillus stearothermophilus

Yang

Park

Nolan

et al. 1997

European Journal of Biochemistry

View full text Add to dashboard Cite

show abstract

“…All cultures were grown at 60°C as previously described [3] in liquid complex medium (TYSC1) or complex medium containing NaNO3 in place of NaC1 (TYSN). Cultures were also grown on defined liquid medium [ 1 ] containing 1 mg/ml NaCI (DLCI) or 1 mg/ml NaNO3 (DLN). Aerobic cultures were grown in 350 ml baffled nepholometer flasks (BeUco Glass, Vineland, N.J.) containing 200 ml of liquid complex or defined medium with rotation at 250 rev./min.…”

Section: Methodsmentioning

confidence: 99%

“…The thermophile, Bacillus stearothermophilus 1503, has been grown by Rowe and coworkers [ 1 ] aerobicaily on both liquid and solid defined and minimal medium through several generations. Since agar medium permits isolation of many desirable auxotrophies, we attempted to grow//, stearothermophilus NCA 2184 aerobically and anaerobically on a defined liquid or solid medium containing nitrate in the hope of obtaining non-nitrate reducing mutants.…”

Section: Introductionmentioning

confidence: 99%

Peptide requirement in the biosynthesis of nitrate reductase in Bacillus stearothermophilus

Downey

1978

FEMS Microbiology Letters

View full text Add to dashboard Cite

“…Primers 27F (GAGAGTTTGATCCTGGCTCA-G), 765R (CTGTTTGCTCCCCACGCTTC), and 1495R (CTACGGCTACCTTGTTACGA) were universal primers for eubacterial 16S rDNA [20]. Three additional primers were designed on the basis of alignments of Bacillus 16S rDNA sequences: 400F (GGAGCGACGCCGCGTGAGCG), 700F (GCA-ACTGACGCTGAGGCG), and 1000F (GCAAC-GCGAAGAACCTTA).…”

Section: Oligonucleotide Primersmentioning

confidence: 99%

Phylogenetic analysis of transformable strains of thermophilic Bacillus species

Studholme¹

1999

FEMS Microbiology Letters

View full text Add to dashboard Cite

Few strains of thermophilic Bacillus spp are readily transformable with plasmid DNA. Given the considerable phylogenetic and phenotypic diversity amongst thermophilic bacilli, we have examined whether transformability is a trait associated with a particular phylogenetic group, by sequencing the 16S ribosomal RNA genes from transformable strains NUB3621, K1041, and NRRL1174. Although all of these strains were described in the literature as B. stearothermophilus, only NRRL1174 is closely related to the type strain of this species. Based on its 16S rDNA sequence and physiological data K1041 appeared to belong to the species B. thermodenitrificans, while NUB3621 showed a slightly closer relationship to B. thermoglucosidasius than to B. stearothermophilus. Therefore we conclude that the trait of transformability, though possibly strain-specific, is not limited to a single species of thermophilic Bacillus. z

show abstract

Development of defined and minimal media for the growth of Bacillus stearothermophilus

Cited by 44 publications

References 3 publications

Cloning and Characterization of the Arginine‐Specific Carbamoyl‐Phosphate Synthetase from Bacillus stearothermophilus

Cloning and Characterization of the Arginine‐Specific Carbamoyl‐Phosphate Synthetase from Bacillus stearothermophilus

Peptide requirement in the biosynthesis of nitrate reductase in Bacillus stearothermophilus

Phylogenetic analysis of transformable strains of thermophilic Bacillus species

Contact Info

Product

Resources

About