Development of Specific Markers for Identification of Biovars 1 and 2 Strains of Pseudomonas syringae pv. actinidiae

Kim, Gyoung Hee; Koh, Young Jin; Zhuang, Qiguo; Jung, Jae Sung

doi:10.5423/ppj.nt.10.2015.0224

Cited by 16 publications

(9 citation statements)

References 24 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Plant samples were collected for three years (2013–2015) from kiwifruit orchards infected with canker and were examined using the multiplex PCR methods by Koh et al (2014) and Lee et al (2016) (Fig. 1).…”

Section: Resultsmentioning

confidence: 99%

“…Each bacterium was propagated in a liquid medium by incubating for 18 h at 25°C and 200 rpm. Multiplex PCRs developed by Koh et al (2014) and Lee et al (2016) were then used to determine whether the isolated bacterium is Psa2 or Psa3. Psa3 strains were confirmed to not possess gene fragments of the cfl gene coding for coronatine (Han et al, 2003) nor fragments of the tox-argK gene cluster coding for phaseolotoxin (Sawada et al, 2002).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Outbreak and Spread of Bacterial Canker of Kiwifruit Caused by Pseudomonas syringae pv. actinidiae Biovar 3 in Korea

Kim

Son

et al. 2016

The Plant Pathology Journal

Self Cite

View full text Add to dashboard Cite

A bacterial pathogen, Pseudomonas syringae pv. actinidiae (Psa), is a causal agent of kiwifruit bacterial canker worldwide. Psa biovar 3 (Psa3) was first detected in 2011 at an orchard in Dodeok-myeon, Goheunggun, Jeonnam Province in Korea. In this study, we present the results of an epidemiological study regarding Psa3 occurrence on kiwifruit orchards in Korea for the period of 2013 to 2015. Since the first detection of Psa3 in 2011, there was no further case reported by 2013. However, Psa3 was rapidly spreading to 33 orchards in 2014; except for three orchards in Sacheonsi, Gyeongnam Province, most cases were reported in Jeju Island. Entering 2015, bacterial canker by Psa3 became a pandemic in Korea, spreading to 72 orchards in Jeju Island, Jeonnam, and Gyeongnam Provinces. Our epidemiological study indicated that the first Psa3 incidence in 2011 might result from an introduction of Psa3 through imported seedlings from China in 2006. Apart from this, it was estimated that most Psa3 outbreaks from 2014 to 2015 were caused by pollens imported from New Zealand and China for artificial pollination. Most kiwifruit cultivars growing in Korea were infected with Psa3; yellow-fleshed cultivars (Yellow-king, Hort16A, Enza-gold, Zecy-gold, and Haegeum), red-fleshed cultivars (Hongyang and Enza-Red), green-fleshed cultivars (Hayward and Daeheung), and even a kiwiberry (Skinny-green). However, susceptibility to canker differed among cultivars; yellow- and red-fleshed cultivars showed much more severe symptoms compared to the green-fleshed cultivars of kiwifruit and a kiwiberry.

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Outbreak and Spread of Bacterial Canker of Kiwifruit Caused by Pseudomonas syringae pv. actinidiae Biovar 3 in Korea

Kim

Son

et al. 2016

The Plant Pathology Journal

Self Cite

View full text Add to dashboard Cite

show abstract

“…The primer's sequences were F1: TTTTGCTTTGCACACCCGATTTT; R2: CAGGCACCCTTCAATCAGGATG. PCR to identify biovar and were performed as described in (Lee et al 2016); the primer sequences to identify biovar 1 were PsaJ-F: GACGTCGACGACAAGGTGAT and PsaJ-R AGTAAACCGTGCCGTCATCTC and for biovar 2 were PsaJ-R: AGTAAACCGTGCCGTCATCTC and PsaK-F GACAAAGCCAAAAAGGCGA.…”

Section: Identification Of Psa By Pcrmentioning

confidence: 99%

Characterization of Chilean Pseudomonas syringae pv actinidiae strains isolated from infected orchards

Parada

Orellana

Amaza

et al. 2017

Preprint

View full text Add to dashboard Cite

Pseudomonas syringae pv. actinidiae (PSA) strain is a major problem for the kiwifruit industry worldwide. So far, 5 biovars of PSA have been identified, of which the most virulent form is biovar 3. This is the only biovar that has been detected in Chile, which is the third kiwifruit exporter country and is currently suffering from canker disease produced by PSA. Single nucleotide polymorphisms (SNPs) analyses have classified the biovar 3 strain into three groups: the European, the New Zealander and the Chilean groups, which have evolved from a common Chinese PSA ancestor. Although Chilean strains have been used in phylogenetic analysis, there is no information about genomic diversity within this group or whether they present microbiological characteristics that could affect its virulence. In this work we studied 15 Chilean bacterial isolates collected from orchards with canker disease symptoms, and classified them as PSA using a different PCR techniques. To gain more information on the relationship between the isolates we sequenced part of three conserved genes widely used to classify bacterial strains: gtl (Citrate Synthase), rpoD (Sigma subunit of RNA polymerase II) and gyrB (Gyrase B). Using these sequences we performed a phylogenetic analysis that included some PSA reference sequences. Fourteen PSA Chilean isolates were grouped with PSA reference strains and three of them formed a subgroup within the PSA clade, suggesting clear differences at the genomic level among the isolates. We evaluated three microbiological traits in all the isolates: motility (swimming and swarming), and ability to induce a hypersensitive response in tobacco plants. All the isolates were able to induce the hypersensitive response in tobacco plants and were also able to perform both types of movements in appropriated growing conditions.

show abstract

“…P. syringae pv. actinidiae studies are so far focused mainly on its identification and pathogen differentiation (Koh and Nou 2002;Koh et al 2014;Lee et al 2016), its origin, evolution and epidemic spread (Butler et al 2013;Chapman et al 2012;Ciarroni et al 2015;Cunty et al 2015;Mazzaglia et al 2012;Scortichini et al 2012;Vanneste et al 2013), genome sequence analyses ( (Petriccione et al 2013(Petriccione et al , 2014, and its management either of using resistant host lines or use of bacteriophages (Di Lallo et al 2014;Yu et al 2016) and chemical compounds (Cameron et al 2014;Ghods et al 2015).…”

mentioning

confidence: 99%

Identification of Loci ofPseudomonas syringaepv.actinidiaeInvolved in Lipolytic Activity and Their Role in Colonization of Kiwifruit Leaves

et al. 2017

View full text Add to dashboard Cite

Bacterial canker disease caused by Pseudomonas syringae pv. actinidiae, an emerging pathogen of kiwifruit plants, has recently brought about major economic losses worldwide. Genetic studies on virulence functions of P. syringae pv. actinidiae have not yet been reported and there is little experimental data regarding bacterial genes involved in pathogenesis. In this study, we performed a genetic screen in order to identify transposon mutants altered in the lipolytic activity because it is known that mechanisms of regulation, production, and secretion of enzymes often play crucial roles in virulence of plant pathogens. We aimed to identify the set of secretion and global regulatory loci that control lipolytic activity and also play important roles in in planta fitness. Our screen for altered lipolytic activity phenotype identified a total of 58 Tn5 transposon mutants. Mapping all these Tn5 mutants revealed that the transposons were inserted in genes that play roles in cell division, chemotaxis, metabolism, movement, recombination, regulation, signal transduction, and transport as well as a few unknown functions. Several of these identified P. syringae pv. actinidiae Tn5 mutants, notably the functions affected in phosphomannomutase AlgC, lipid A biosynthesis acyltransferase, glutamate-cysteine ligase, and the type IV pilus protein PilI, were also found affected in in planta survival and/or growth in kiwifruit plants. The results of the genetic screen and identification of novel loci involved in in planta fitness of P. syringae pv. actinidiae are presented and discussed.

show abstract

Development of Specific Markers for Identification of Biovars 1 and 2 Strains of Pseudomonas syringae pv. actinidiae

Cited by 16 publications

References 24 publications

Outbreak and Spread of Bacterial Canker of Kiwifruit Caused by Pseudomonas syringae pv. actinidiae Biovar 3 in Korea

Outbreak and Spread of Bacterial Canker of Kiwifruit Caused by Pseudomonas syringae pv. actinidiae Biovar 3 in Korea

Characterization of Chilean Pseudomonas syringae pv actinidiae strains isolated from infected orchards

Identification of Loci ofPseudomonas syringaepv.actinidiaeInvolved in Lipolytic Activity and Their Role in Colonization of Kiwifruit Leaves

Contact Info

Product

Resources

About