Diagnostic accuracy of rapid diagnostic tests for the early detection of leptospirosis

Alia, Siti N.; Joseph, Narcisse; Philip, Noraini; Azhari, Nurul Natasya; Garba, Bashiru; Masri, Siti Norbaya; Sekawi, Zamberi; Neela, Vasantha Kumari

doi:10.1016/j.jiph.2018.10.137

Cited by 28 publications

(34 citation statements)

References 16 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…For serology, all serum samples were subjected to MAT as described earlier [ 14 ]. MAT was performed using a panel of 20 local and international serovars comprising of pathogenic and non-pathogenic leptospires.…”

Section: Methodsmentioning

confidence: 99%

“…Detection of Leptospira based on visualization (microscopy examination) and culture had been considered ineffective as microscopy could not detect the low number of Leptospira in clinical specimens [10,11] with its low specificity [12] and the need for long incubation period (minimum four weeks) for culture. Serological kits such as enzyme-linked immunosorbent assay (ELISA) and rapid tests are also available, however, most suffer from low sensitivity and specificity [13][14][15][16]. Currently, the confirmatory methods for diagnosis of leptospirosis include the serology based microscopic agglutination test (MAT) and molecular-based polymerase-chain reaction (PCR).…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Combined PCR and MAT improves the early diagnosis of the biphasic illness leptospirosis

et al. 2020

Self Cite

View full text Add to dashboard Cite

The diagnosis of leptospirosis remains a challenge due to its non-specific symptoms and the biphasic nature of the illness. A comprehensive diagnosis that includes both molecular (polymerase chain reaction (PCR)) and serology is vital for early detection of leptospirosis and to avoid misdiagnosis. However, not all samples could be subjected to both tests (serology and molecular) due to budget limitation, infrastructure, and technical expertise at least in resource-limited countries. We evaluated the usefulness of testing the clinically suspected leptospirosis cases with both techniques on all samples collected from the patients on the day of admission. Among the 165 patient's blood/serum samples tested (from three hospitals in Central Malaysia), 43 (26%) showed positivity by microscopic agglutination test (MAT), 63 (38%) by PCR, while 14 (8%) were positive by both MAT and PCR. For PCR, we tested two molecular targets (lipL32 by qPCR and 16S rDNA or rrs by nested PCR) and detected lipL32 in 47 (29%) and rrs gene in 63 (38%) patients. The use of more than one target gene for PCR increased the detection rates. Hence, a highly sensitive multiplex PCR targeting more than one diagnostic marker is recommended for the early detection of Leptospira in suspected patients. When the frequencies for positivity detected either by MAT or PCR combined, leptospirosis was diagnosed in a total of 92 (56%) patients, a higher frequency compared to when samples were only tested by a single method (MAT or PCR). The results from this study suggest the inclusion of both serology and molecular methods for every first sample irrespective of the days post-onset of symptoms (DPO) collected from patients for early diagnosis of leptospirosis.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Combined PCR and MAT improves the early diagnosis of the biphasic illness leptospirosis

et al. 2020

Self Cite

View full text Add to dashboard Cite

show abstract

“…To determine the seropositivity, all serum samples were subjected to MAT as described earlier [15]. For molecular detection and identification, a 242 bp lipL32 fragment (primers: LipL32-45F: AAGCATTACCGCTTGTGGTG, LipL32-286R: GAACTC CCATTTCAGCGA TT, probe: LipL32-189P: FAM-5 0 -AAAGCCAGGACAAGCGCCG-3 0 -BHQ1) [16] which is only present in pathogenic Leptospira and the 547 bp fragment of 16S rDNA (rrs) nested PCR assays (outer primers: rrsouter-F: CTCAGAACTAACGCTGGCGGCGCG, rrs-outer-R: GGTTCGT TACTGAGGGTTAAAACCCCC, inner primers: rrs-inner-F: CTGGCGGCGCGTCTTA, rrsinner-R: GTTTTCACACCTGACTTACA) [17] were performed in all samples.…”

Section: Serology and Molecular Characterizationmentioning

confidence: 99%

Leptospira interrogans and Leptospira kirschneri are the dominant Leptospira species causing human leptospirosis in Central Malaysia

et al. 2020

Self Cite

View full text Add to dashboard Cite

Background Leptospirosis, commonly known as rat-urine disease, is a global but endemic zoonotic disease in the tropics. Despite the historical report of leptospirosis in Malaysia, the information on human-infecting species is limited. Determining the circulating species is important to understand its epidemiology, thereby to strategize appropriate control measures through public health interventions, diagnostics, therapeutics and vaccine development. Methodology/Principle findings We investigated the human-infecting Leptospira species in blood and serum samples collected from clinically suspected leptospirosis patients admitted to three tertiary care hospitals in Malaysia. From a total of 165 patients, 92 (56%) were confirmed cases of leptospirosis through Microscopic Agglutination Test (MAT) (n = 43; 47%), Polymerase Chain Reaction (PCR) (n = 63; 68%) or both MAT and PCR (n = 14; 15%). The infecting Leptospira spp., determined by partial 16S rDNA (rrs) gene sequencing revealed two pathogenic species namely Leptospira interrogans (n = 44, 70%) and Leptospira kirschneri (n = 17, 27%) and one intermediate species Leptospira wolffii (n = 2, 3%). Multilocus sequence typing (MLST) identified an isolate of L. interrogans as a novel sequence type (ST 265),

show abstract

“…The samples positive by 16S rDNA were subjected to sequencing (MyTACG Bioscience Enterprise, Malaysia) to identify the infecting Leptospira species [1]. The serovars used for MAT assay comprised Australis, Autumnalis, Batavia, Canicola, Celledoni, Grippotyphosa, Hardjoprajitno, Icterohaemorrhagiae, Javanica, Pyrogenes, Tarrasovi, Djasiman, Patoc, Pomona (international serovars were obtained from World Health Organization, WHO) and IMR LEP 1; saprophyte, IMR LEP 115; saprophyte, IMR LEP 175; saprophyte, IMR LEP 803/11-Copenhageni, IMR LEP 27-Hardjobovis, IMR LEP 22-Lai (local serovars were obtained from the Institute for Medical Research (IMR), Federal Territory of Kuala Lumpur, Malaysia [19,20].…”

Section: Methodsmentioning

confidence: 99%

Predictors of Severe Leptospirosis: A Multicentre Observational Study From Central Malaysia

Philip

Than

et al. 2021

Preprint

Self Cite

View full text Add to dashboard Cite

Background: Leptospirosis is a re-emerging disease with vast clinical presentations ranges from subclinical or mild, to severe and fatal outcomes. Though leptospirosis can be managed well if diagnosed earlier, similar clinical presentations by several other febrile illnesses or co-infections often result in mis- or underdiagnosis, thereby lead to severe illness. Identification of clinical predictors for the severe form of the disease plays a crucial role in reducing disease complication and mortality. Therefore, we aimed to determine the clinical predictors associated with severe illness among leptospirosis patients from Central Malaysia through a prospective multicenter observational study. Methods: Data were collected from case records of 83 confirmed leptospirosis patients comprising of 33 severe and 50 mild. Statistical analysis was performed using χ2 and multivariable logistic regression test with Epi info software. Results: We identified mechanical ventilation, AKI, septic shock, creatinine level of >1.13mg/dL, ALT >50IU, AST >50IU, and platelet <150 x 109/L as factors associated with severe illness. AKI, ALT >50IU and platelet <150 x 109/L were defined as the independent factors for severity. Conclusions: Lungs, liver and kidney involvement, and septic shock were found as the prognostic factors for severe leptospirosis. AKI, high level of ALT and low level of platelets were found to be independent predictors of severity.

show abstract

Diagnostic accuracy of rapid diagnostic tests for the early detection of leptospirosis

Cited by 28 publications

References 16 publications

Combined PCR and MAT improves the early diagnosis of the biphasic illness leptospirosis

Combined PCR and MAT improves the early diagnosis of the biphasic illness leptospirosis

Leptospira interrogans and Leptospira kirschneri are the dominant Leptospira species causing human leptospirosis in Central Malaysia

Predictors of Severe Leptospirosis: A Multicentre Observational Study From Central Malaysia

Contact Info

Product

Resources

About