Diagnostic Value of Different PCR Assays for the Detection of Mycobacterial Dna in Granulomatous Lymphadenopathy

Tötsch, Martin; Böcker, W.; Brömmelkamp, Elisabeth; Fille, Manfred; Kreczy, Alfons; Öfner, Dietmar; Schmid, Kurt Werner; Dockhorn‐Dworniczak, Barbara

doi:10.1002/(sici)1096-9896(199602)178:2<221::aid-path441>3.0.co;2-w

Cited by 42 publications

(28 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Conventional techniques for isolation and identification of TB can be time-consuming and delay treatment. Molecular investigation by means of the polymerase chain reaction allows rapid diagnosis and subtyping of the mycobacteria, 6,7 and an even quicker technique with a specific DNA-probe can be applied to the small clinical specimen collected by fine-needle aspiration. 8 However, these techniques are not yet routinely available in most UK otolaryngology and head and neck centres.…”

Section: J O U R N a L O F T H E R O Y A L S O C I E T Y O F M E D I mentioning

confidence: 99%

4 years' experience of head and neck tuberculosis in a south London hospital

Choudhury

Bruch

Kothari

et al. 2005

Journal of the Royal Society of Medicine

View full text Add to dashboard Cite

SUMMARYIn a south London department of otorhinolaryngology and head and neck surgery, 33 cases of tuberculosis were diagnosed in 4 years. The most common presentation was cervical adenitis (58%) and in some cases the initial investigations suggested malignant disease. Most of the patients were of non-British origin but none proved to be HIV seropositive. Fine-needle aspiration was positive for tuberculosis in 7 of 19 patients. 21 patients required a surgical procedure for diagnosis. INTRODUCTIONTuberculosis (TB) is the world's leading cause of death from a single infective agent and a rising incidence has caused the World Health Organization to declare the disease a global emergency. 1,2 Among the factors associated with the reversal of a previous decline are increased global travel and a rising prevalence of immunodeficiency through HIV infections or drug therapy. In the UK, pulmonary tuberculosis is the most common manifestation but extrapulmonary disease is likewise increasing. Here we review four years' experience of head and neck tuberculosis-a condition that can present diagnostic and therapeutic challenges. METHODSWe retrospectively reviewed the case notes of all patients with proven extrapulmonary tuberculosis seen in the Otorhinolaryngology and Head and Neck Department of University Hospital Lewisham from December 1999 to January 2004. (All patients had then been referred to a TB clinic in the Department of Chest Medicine for further management.) Routine tests included full blood count, C-reactive protein and a chest X-ray. Patients with neck, thyroid and salivary gland masses underwent ultrasoundguided fine-needle aspiration, with cytological and microbiological examination including staining for acid-fast bacilli (Ziehl-Neelsen). Where tuberculosis was suspected, sputum samples were obtained for Ziehl-Neelsen staining.In patients with inconclusive results further biopsies were taken for microbiological analysis, including culture on Löwenstein-Jensen medium, and histological assessment. Patients with proven TB were subsequently counselled and tested for HIV at the chest clinic. RESULTS33 patients were seen over the study period, 21 male 12 female, mean age 40 years (range 21-75). 15 had a history of previous TB contact. 18 were of South Asian origin and only 'Caucasian'. In 19 patients (58%), the presenting feature was cervical lymphadenitis. In addition, 9 had salivary gland TB, 2 laryngeal TB, and 1 each nasopharyngeal, hypopharyngeal and ear TB. 21 patients required some sort of surgical procedure for diagnosis (Figure 1). In 12 patients the disease was producing constitutional symptoms such as fever, weight loss or night sweats. None of the patients proved to be HIV positive. 16 had evidence of TB on their chest X-ray.The modes of microbiological and histopathological assessment were Ziehl-Neelsen stain 12/33, Mycobacterium tuberculosis culture 18/29 and histopathology 21/21. No patient had an atypical mycobacterial infection but in 2 the organism was resistant-in one case to streptomycin and in t...

show abstract

Section: J O U R N a L O F T H E R O Y A L S O C I E T Y O F M E D I mentioning

confidence: 99%

4 years' experience of head and neck tuberculosis in a south London hospital

Choudhury

Bruch

Kothari

et al. 2005

Journal of the Royal Society of Medicine

View full text Add to dashboard Cite

show abstract

“…False-negative PCR results also might be a consequence of the small amount of tissue examined, as compared with the amount used for bacterial culture. In a recent study of PCR detection of mycobacterial DNA in paraffin blocks of human granulomatous lymphadenopathy, 26 the percentage of positive cases was markedly improved if multiple sections at different levels of the block were examined. The authors concluded that a multiple sampling protocol improved test efficiency because bacteria were unevenly distributed in the tissues.…”

Section: Discussionmentioning

confidence: 99%

“…A number of studies have incorporated the polymerase chain reaction (PCR) into techniques for detection or identification of mycobacteria in for-malin-fixed, paraffin-embedded tissues of humans 2,5,6,[8][9][10][11][12]19,20,22,[24][25][26] There are no reports of use of the technique for diagnosing tuberculosis in animals, but the procedure has been used to identify M. paratuberculosis in cattle with Johne's disease. 21 In this paper, we describe a PCR test that has been very effective for diagnosing tuberculosis using paraffin sections of diagnostic samples submitted as part of the US bovine tuberculosis eradication program.…”

mentioning

confidence: 99%

Detection of Mycobacterium Bovis in Formalin-Fixed, Paraffin-Embedded Tissues of Cattle and Elk by PCR Amplification of an IS6110 Sequence Specific for Mycobacterium Tuberculosis Complex Organisms

et al. 1997

View full text Add to dashboard Cite

Abstract.A presumptive diagnosis of tuberculosis can be made if a tissue has characteristic histopathologic changes and acid-fast organisms. However, definitive diagnosis requires culture and species identification of the causative mycobacterium, a process that takes several weeks to complete. The purpose of work reported here was to determine if formalin-fixed, paraffin-embedded tissues could be tested by polymerase chain reaction (PCR) to provide a more rapid diagnosis of tuberculosis. Nondecalcified tissues from cases of tuberculosis in cattle and elk (Cervus elaphus) were examined. The primers used for PCR amplified a 123-bp fragment of IS6110, an insertion sequence that is specific for organisms in the Mycobacterium tuberculosis complex ( M. tuberculosis, M. bovis, M. microti, M. africanum). The PCR test detected this sequence in tissues from 92 of 99 (93%) tuberculosis cases, including 3 of 4 elk. In 80 tissues, the positive results were obtained using material prepared by immersion of paraffin sections in water containing a detergent, followed by alternating boil/freeze cycles. The remaining positive results were obtained with DNA isolated from the crude tissue extracts by proteinase K digestion and phenol/chloroform purification. Accuracy of the IS6110 PCR test was demonstrated by negative test results on 31 tissues that had either nonmycobacterial granulomas or granulomatous lesions caused by other mycobacteria (M. paratuberculosis or M. avium). The findings of this study show that a PCR test usually can provide a rapid diagnosis of tuberculosis when it is applied to paraffin sections that have characteristic lesions and acid-fast organisms.The United States has been actively pursuing the goal of bovine tuberculosis eradication for almost a century, and that objective has nearly been achieved. Most of the initial progress was made by using the caudal fold skin test to identify infected herds, which were then eliminated, but current regulatory efforts are focused on surveillance methods to identify infected animals. The cases are then traced to the herd of origin for further testing or other appropriate resolution of the problem.Tuberculosis surveillance depends on detection of gross lesions by regulatory officials in meat inspection facilities or by pathologists in state diagnostic laboratories. In some cases, suspect tissues are obtained from animals other than domestic cattle, usually farmed elk (Cervus elaphus) and deer, but occasionally from other captive ruminant species or from free-ranging wildlife. Formalin-fixed tissue samples are routinely submitted for histopathologic examination, and in most

show abstract

“…The pair of primer A and B (5'ACCAACGATGGTGTGTCCAT3' and 3' CTTGTCGAACCGCATACCCT5', respectively) amplify a 439 bp fragment of hsp65 gene. Next, a nested PCR was performed using primers pairs C and D (5'GAGATCGA GCTGGAGGATCC3' and 3'AGCTGCACCCCAAAG GTGTT5', respectively) to originate a 383 bp fragment inside the 439 bp product (Totsch et al 1996).…”

Section: Methodsmentioning

confidence: 99%