Dicer is required for proliferation, viability, migration and differentiation in corticoneurogenesis

Abstract

In mice, microRNAs (miRNAs) are required for embryonic viability, and previous reports implicate miRNA participation in brain cortical neurogenesis. Here, we provide a more comprehensive analysis of miRNA involvement in cortical brain development. To accomplish this we used mice in which Dicer, the RNase III enzyme necessary for canonical miRNA biogenesis, is depleted from Nestin expressing progenitors and progeny cells. We systematically assessed how Dicer depletion impacts proliferation, cell death, migration and differentiation in the developing brain. Using markers for proliferation and in vivo labeling with thymidine analogs, we found reduced numbers of proliferating cells, and altered cell cycle kinetics from embryonic day 15.5 (E15.5). Progenitor cells were distributed aberrantly throughout the cortex rather than restricted to the ventricular and subventricular zones. Activated Caspase3 was elevated, reflecting increased cortical cell death as early as E15.5. Cajal-Retzius positive cells were more numerous at E15.5 and were dysmorphic relative to control cortices. Consistent with this, Reelin levels were enhanced. Doublecortin and Rnd2 were also increased and showed altered distribution, supporting a strong regulatory role for miRNAs in both early and late neuronal migration. In addition, GFAP staining at E15.5 was more intense and disorganized throughout the cortex with Dicer depletion. These results significantly extend earlier works, and emphasize the impact of miRNAs on neural progenitor cell proliferation, apoptosis, migration, and differentiation in the developing mammalian brain.

MicroRNAs in neural development: from master regulators to fine-tuners

“…The RNAse III enzyme Dicer1 is crucial for the biogenesis of most cellular small RNAs, including miRNAs, and Dicer loss-of-function models have thus been widely used for the investigation of miRNA function in neural development in intact animals (Choi et al, 2008;Giraldez et al, 2005;Huang et al, 2010;Kim et al, 2007;McLoughlin et al, 2012;Schaefer et al, 2007). However, there are several caveats that have to be considered when using Dicer-deficient animals.…”

“…The systemic knockout of Dicer1, for example, leads to early embryonic death due to death of differentiating cells (Bernstein et al, 2003). Even when Dicer1 deletion is performed at later stages of neuronal development or in specific brain tissues, increased cell death is repeatedly observed (Davis et al, 2008;De Pietri Tonelli et al, 2008;Huang et al, 2010;McLoughlin et al, 2012;Schaefer et al, 2007), narrowing the time window in which specific biological questions (except cell survival) can be addressed. This might also explain why slightly different strategies for conditional Dicer knockout during embryonic development, such as using either Foxg1-Cre (Nowakowski et al, 2011) or Emx1-Cre (De Pietri Tonelli et al, 2008), have very different effects on NPC specification.…”

Peri-Implantation Hormonal Milieu: Elucidating Mechanisms of Adverse Neurodevelopmental Outcomes

“…29 Neuronal differentiation and migration has been shown to require proper miRNA function. [30][31][32] The roles of several miRNAs in regulating neuronal development have been described. [33][34][35] Our data indicate that exposure to superovulation in the first few days of life alters fetal neuroprogramming, and the aberrations in gene and miRNA expression involved in neuronal migration, differentiation, and cell death are not only confirmed by qPCR in perinatal period but also have lasting implications into adulthood, as there are fewer cortical neurons in the group subjected to superovulation.…”

RNAi or overexpression: Alternative therapies for Spinocerebellar Ataxia Type 1

“…The DNA construct band was purified using a QIAquick Gel Extraction Kit (Qiagen, Valencia, CA) per manufacturer's protocol. The purified DNA insert was ligated (T4 DNA Ligase; NEB, Ipswich, MA) into pFBAAVmcsBGHpA pre-digested with BamHI and NheI (McLoughlin et al, 2012). EF1α was cloned from pBUD plasmid using forward primer 5′ TTAATTAAGTGAGGCTCCGGTGCCCGTC containing a PacI site and reverse primer 5′ GCTAGCGCCAGATC TCTCGAGTCCAC containing a NheI site into pCR™4-TOPO® plasmid (Life Technologies, Grand Island, NY).…”

“…AAV.miS1.eGFP injected samples were verified for expression by eGFP fluorescence before treatment. Sections were treated by ISH methods previously described (McLoughlin et al, 2012). …”