Dietary lysine requirement of freshwater catfish (Mystus nemurus Cuv. & Val.)

Abstract

Production of freshwater catfish (Mystus numerus Cuv. & Val.) has soared to meet consumer demand, but little is known about the nutritional requirements of the species. This study was conducted to determine the dietary lysine requirement of juvenile Mystus numerus fed semipurified diets containing graded levels of lysine. The control diet contained fish meal, gelatin and crystalline amino acids simulating the amino acid profile of Mystus nemurus muscle protein except for lysine. Seven experimental diets were formulated to contain lysine as 0.7% (2.00%), 1.1% (3.14%), 1.5% (4.29%), 1.9% (5.43%), 2.3% (6.57%), 2.7% (7.71%) and 3.1% (8.86%) of the diet (% of protein). Triplicate groups of fish were fed to satiation for 90 days. Specific growth rate, feed efficiency ratio, protein efficiency ratio, productive protein value and daily net protein retention of fish fed diets containing lysine at 2.00% of protein were significantly lower than fish fed diets containing lysine at higher levels. Plasma ammonia concentrations were similar in all groups of fish. A digestibility trial between fish fed the experimental diet with 7.71% of lysine and a diet with fish meal as the sole source of protein showed that protein digestibility of the experimental diet was significantly higher than that of the fish meal based diet. Non‐linear regression analysis of specific growth rate against dietary lysine levels indicated a lysine requirement of 3.47% of protein for this species.

Dietary lysine requirement of juvenile swimming crab, Portunus trituberculatus

“…WG, SGR and FE did significantly increase with the increase of the dietary lysine levels from 1.58% to 2.41%, while they significantly decreased when dietary lysine levels exceeded the lysine requirement. These results were consistent with some previous reports (Murillo-Gurrea et al, 2001;Tantikitti and Chimsung, 2001;Encarnação et al, 2004;Ahmed and Khan, 2004;Mai et al, 2006;Zhou et al, 2007;Peres and Oliva-Teles, 2008). Similarly, excessive dietary lysine was reported to depress growth performance and feed utilization (NRC, 2011).…”

The impaired intestinal mucosal immune system by valine deficiency for young grass carp (Ctenopharyngodon idella) is associated with decreasing immune status and regulating tight junction proteins transcript abundance in the intestine

“…PAC was assayed as described by Tantikitti and Chimsung [40], the protein concentration of tissue samples was determined by the method of Ji et al [41]. Activities of lysozyme and acid phosphatase were determined according to the method described by Deng et al [39] and Classics Barka and Anderson [42], respectively.…”

Effect of dietary leucine on the growth parameters and expression of antioxidant, immune, and inflammatory genes in the head kidney of Labeo rohita fingerlings

“…ATA GGA ATC GGA GTA G Lysozyme C-type CGC TGT GAT GTT GTC CGT ATC TTC 95 • C 30 s, 40 cycles of 95 • C 5 s, 60.3 • C 30 s and 72 • C 30 s Kar et al (2013) GTA ACT TCC CCA CGT ATC C IgM CTC TCA ATC TGT TCA GGG AC 95 • C 30 s, 40 cycles of 95 • C 5 s, 60.3 • C 30 s and 72 • C 30 s Kar et al (2013) GAA GCT TTA CAT GTG TAA GG ␤2-microglobulin TCC AGT CCC AAG ATT CAG GTG 95 • C 30 s, 40 cycles of 95 • C 5 s, 60.3 • C 30 s and 72 • C 30 s AM774150 TGG TGA GGT GAA ACT GCC AG NKEF-␤ ACC GAT CAT CGC GTT C 95 • C 30 s, 40 cycles of 95 • C 5 s, 61.5 • C 30 s and 72 • C 30 s Kar et al (2013) CCG GCA GGT CAT TGA TG TLR22 TCA CCC CAT TTC GAG GCT AAC AT 95 • C 30 s, 40 cycles of 95 • C 5 s, 60.3 • C 30 s and 72 • C 30 s FN548000 GAA GGC GTC GTA CTG GAA TGT C SOD ACGAGACCTGTAGTGCCCTGC 95 • C 30 s, 40 cycles of 95 • C 5 s, 60.3 • C 30 s and 72 • C 30 s Kar et al (2013) CGGAAGCCATCAAGCGTG GPx GGG CTG GTT ATT CTG GGC 95 • C 30 s, 40 cycles of 95 • C 5 s, 62.5 • C 30 s and 72 • C 30 s EU828796 AGG CGA TGT CAT TCC TGT TC Nrf2 CTG GAC GAG GAG ACT GGA 95 • C 30 s, 40 cycles of 95 • C 5 s, 62.5 • C 30 s and 72 • C 30 s KF733814 ATC TGT GGT AGG TGG AAC Keap1 TTC CAC GCC CTC CTC AA 95 • C 30 s, 40 cycles of 95 • C 5 s, 62.5 • C 30 s and 72 • C 30 s KF811013 TGTACCCTCCCGCTATG ␤-actin GAC TTC GAG CAG GAG ATG G 9 5 • C 30 s, 40 cycles of 95 • C 5 s, 62.5 • C 30 s and 72 • C 30 s Mohanty and Sahoo (2010) CAA GAA GGA TGG CTG GAA CA ammonia concentration by the method ofTantikitti and Chimsung (2001).…”