Differences in Caveolae Dynamics in Vascular Smooth Muscle Cells of Different Phenotypes

Thyberg, Johan

doi:10.1038/labinvest.3780095

Cited by 49 publications

(48 citation statements)

References 47 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Caveolin-1 may in part be responsible for SMC phenotype change from contractile to synthetic. It is worthy of note that caveolae are more numerous in contractile phenotype, and caveolin-1 mainly localizes in caveolae (124). The dual role of caveolin-1 in PH is not unlike what is observed in cancer.…”

Section: Enhanced Expression Of Caveolin-1 In Smcs Loss Of Endothelimentioning

confidence: 99%

Pathogenesis of pulmonary hypertension: a case for caveolin-1 and cell membrane integrity

Mathew

2014

American Journal of Physiology-Heart and Circulatory Physiology

View full text Add to dashboard Cite

Mathew R. Pathogenesis of pulmonary hypertension: a case for caveolin-1 and cell membrane integrity. Am J Physiol Heart Circ Physiol 306: H15-H25, 2014. First published October 25, 2013 doi:10.1152/ajpheart.00266.2013.-Pulmonary hypertension (PH) is a progressive disease with a high morbidity and mortality rate. Despite important advances in the field, the precise mechanisms leading to PH are not yet understood. Main features of PH are loss of vasodilatory response, the activation of proliferative and antiapoptotic pathways leading to pulmonary vascular remodeling and obstruction, elevated pressure and right ventricular hypertrophy, resulting in right ventricular failure and death. Experimental studies suggest that endothelial dysfunction may be the key underlying feature in PH. Caveolin-1, a major protein constituent of caveolae, interacts with several signaling molecules including the ones implicated in PH and modulates them. Disruption and progressive loss of endothelial caveolin-1 with reciprocal activation of proliferative pathways occur before the onset of PH, and the rescue of caveolin-1 inhibits proliferative pathways and attenuates PH. Extensive endothelial damage/loss occurs during the progression of the disease with subsequent enhanced expression of caveolin-1 in smooth muscle cells. This caveolin-1 in smooth muscle cells switches from being an antiproliferative factor to a proproliferative one and participates in cell proliferation and cell migration, possibly leading to irreversible PH. In contrast, the disruption of endothelial caveolin-1 is not observed in the hypoxia-induced PH, a reversible form of PH. However, proliferative pathways are activated in this model, indicating caveolin-1 dysfunction. Thus disruption or dysfunction of endothelial caveolin-1 leads to PH, and the status of caveolin-1 may determine the reversibility versus irreversibility of PH. This article reviews the role of caveolin-1 and cell membrane integrity in the pathogenesis and progression of PH.caveolin-1; endothelial cells; pulmonary hypertension; smooth muscle cells THIS ARTICLE is part of a collection on Pathophysiology of Hypertension. Other articles appearing in this collection, as well as a full archive of all collections, can be found online at http://ajpheart.physiology.org/.In 1891, Ernst von Romberg, a German physician, described histological changes in pulmonary hypertension (PH) as pulmonary vascular sclerosis (30). Since then remarkable advances have been made in the understanding of PH, but the pathogenesis of PH still remains elusive, partly because a number of diseases can lead to PH and multiple signaling pathways are implicated in PH. Furthermore, not all signaling pathways are activated in a given patient, and their activation may depend on the stage of the disease. Experimental data suggest that the vascular changes occur before the onset of PH (47,48). Therefore, it is not surprising that by the time the diagnosis of PH is made, most patients have significant pathological changes in pulmonary vasculatu...

show abstract

Section: Enhanced Expression Of Caveolin-1 In Smcs Loss Of Endothelimentioning

confidence: 99%

Pathogenesis of pulmonary hypertension: a case for caveolin-1 and cell membrane integrity

Mathew

2014

American Journal of Physiology-Heart and Circulatory Physiology

View full text Add to dashboard Cite

show abstract

“…4) that persisted during integrin ␣2 internalization. Furthermore, integrin ␣2 internalized with GM1, which has been extensively used as a marker for glyco- lipid raft domains (40,41) and is associated with caveolae (53,54). These findings suggest that integrin ␣2 is concentrated in caveolar rafts and internalized by a caveolae-mediated endocytic pathway in response to EGF receptor activation.…”

Section: Activated Egf Receptor Initiates Transient Internalization Ofmentioning

confidence: 57%

Activated Epidermal Growth Factor Receptor Induces Integrin α2 Internalization via Caveolae/Raft-dependent Endocytic Pathway

Ning¹,

Buranda

Hudson³

2007

Journal of Biological Chemistry

View full text Add to dashboard Cite

Elevated expression or activity of the epidermal growth factor (EGF) receptor is common in ovarian cancer and is associated with poor patient prognosis. Our previous studies demonstrated that expression of the constitutively active mutant form of the EGF receptor (EGFRvIII) in ovarian cancer cells led to reduction in integrin ␣2 surface expression, defects in cell spreading, and disruption of focal adhesions. Inhibition of EGFRvIII catalytic activity reversed the response, suggesting that EGF receptor activation regulates integrin ␣2. In this study we found that EGF treatment resulted in a transient loss of integrin ␣2 from the cell surface. Before EGF stimulation, integrin ␣2 and EGF receptors were associated based on biochemical and immuno-colocalization approaches. After EGF treatment, EGF receptor and integrin ␣2 were internalized and segregated into different compartments. Integrin ␣2, but not EGF receptor, was associated with caveolin-1 and GM1 (Gal_1,3GalNAc_1,4(Neu5Ac-_ 2,3)Gal_1,4Glc_1,1-ceramide) gangliosides, suggesting caveolae-mediated endocytosis. Moreover, integrin ␣2 was subsequently targeted to the Golgi apparatus and the endoplasmic reticulum. Together, these findings demonstrate that activated EGF receptor transiently modulates integrin ␣2 cell surface expression and stimulates integrin ␣2 trafficking via caveolae/ raft-mediated endocytosis, representing a novel mechanism by which the EGF receptor may regulate integrin-mediated cell behavior.Epithelial ovarian carcinoma accounts for 80 -90% of ovarian tumors and is the leading cause of death from gynecologic malignancy, resulting in 16,210 deaths in 2005 (1). Because of the current inability to detect disease confined to the ovary (stage I), ϳ75% of women are initially diagnosed with disseminated intra-abdominal disease (stage III-IV) and have a 5-year survival of Ͻ20%, whereas patients diagnosed with cancer localized to the ovary have a Ͼ90% 5-year survival. Clinically, tumors often involve the ovary and omentum, with diffuse intraperitoneal metastases and malignant ascites. Ovarian cancer metastasis results from numerous intraperitoneal adhesive events, suggesting that carcinoma cell integrins regulate subsequent invasive or metastatic behavior (2-4).Integrins are the major family of cell surface receptors that mediate attachment to the extracellular matrix, and these integrin-mediated adhesive interactions are intimately involved in the regulation of many cellular functions, including tumor cell growth, apoptosis, and metastasis (5-7). After disseminated primary ovarian tumor cells attach to the peritoneal mesothelial monolayer via CD44 (8 -10), integrin-mediated cell-matrix interaction potentiates intraperitoneal invasion. Ovarian carcinoma cells extend cytoplasmic processes through the junctional margins of neighboring mesothelial cells, inducing cellular retraction and exposure of the submesothelial extracellular matrix, followed by integrin-mediated adhesion to the newly exposed matrix (11,12). Analysis of adhesive preferences and integ...

show abstract

“…In vitro, the effect of LDL exposure on caveolae density (and cholesterol export) markedly differs according to the phenotype (ie, synthetic versus contractile) of vascular smooth muscle cells. 5 Similar phenotypic differences in response to statins may be anticipated. The fate of caveolin-3, an important isoform in muscle cells, also remains undetermined.…”

Section: Responsementioning

confidence: 83%

Differential Modulation of Caveolin-1 Expression in Cells of the Vasculature by Statins

2004

View full text Add to dashboard Cite

Pelat and coworkers 1 demonstrated that rosuvastatin decreases caveolin-1 expression in the cardiovasculature of dyslipidemic mice. By decreasing the expression of caveolin-1, an inhibitor of endothelial NO synthase, rosuvastatin treatment promotes endothelial NO synthase function and concomitantly stabilizes heart rate and blood pressure variabilities. Thus, rosuvastatin exerts beneficial effects on vascular function beyond those attributed to its lipid-lowering capacity. The authors presume that caveolin-1 downregulation occurs at the endothelial cell level, although they also envisioned additional effects on other vascular cells involved in atherogenesis.We agree that effects of statins on other cells are indeed to be anticipated. In our studies on the molecular mechanisms underlying lipid trafficking via caveolae in human smooth muscle cells (SMC) 2 and macrophages (M⌽), we evaluated caveolin-1 expression in response to the hydrophobic and hydrophilic statins lovastatin and pravastatin using the reverse transcription-polymerase chain reaction on total RNA (primers for human caveolin-1 were as follows: forward, GAGCTGAGCGAGAAG-CAAGT; reverse, ACAGCAAGCGGTAAAACCAG; GenBank accession No, NM-001753), with ␤-actin as an internal standard. Treatment with lovastatin stimulated caveolin-1 expression in SMC. The maximum induction level (8-fold) was reached after 2 days. Pravastatin showed no effect in SMC. In M⌽, however, both statins increased caveolin-1 mRNA expression markedly (lovastatin, 4-fold; pravastatin, 1.8-fold).Thus, statins alter the expression of caveolin-1 differentially in vascular SMC and M⌽. Whether or not caveolin-1 expression is affected by a particular statin evidently depends on the nature of the statin used, because only the hydrophobic lovastatin elicited a response in SMC. Furthermore, the stronger stimulation elicited in M⌽ by lovastatin indicates that the statins have different capabilities to trigger a cellular response. Taken together, these results imply that statin-mediated improvement of vascular function as observed by Pelat and coworkers 1 is attributable to the summative effects of statin on caveolin-1 expression in several kinds of cells of the vessel wall, including at least endothelial cells, SMC, and M⌽. Further, the efficacy of statin treatment may depend on the type of statin used as already shown by other authors (see, eg, Huang et al 3 ). Future studies will be needed to elucidate the mechanisms underlying the effects of statins on specific cells of the vasculature.

show abstract

Differences in Caveolae Dynamics in Vascular Smooth Muscle Cells of Different Phenotypes

Cited by 49 publications

References 47 publications

Pathogenesis of pulmonary hypertension: a case for caveolin-1 and cell membrane integrity

Pathogenesis of pulmonary hypertension: a case for caveolin-1 and cell membrane integrity

Activated Epidermal Growth Factor Receptor Induces Integrin α2 Internalization via Caveolae/Raft-dependent Endocytic Pathway

Differential Modulation of Caveolin-1 Expression in Cells of the Vasculature by Statins

Contact Info

Product

Resources

About