Different Effects of sgRNA Length on CRISPR-mediated Gene Knockout Efficiency

Zhang, Jianping; Li, Xiaolan; Neises, Amanda; Chen, Wanqiu; Hu, Linping; Ji, Guangzhen; Yu, Jun-Yao; Xu, Jing; Yuan, Weiping; Cheng, Tao; Zhang, Xiaobing

doi:10.1038/srep28566

Cited by 89 publications

(76 citation statements)

References 52 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…9 Although there are benefits in using these nucleases, the main downside is the risk for off-target cleavages. Several strategies have been developed, such as using high-fidelity Cas9 10 or using a truncated gRNA 11 to reduce off-target effects. Methods such as droplet digital polymerase chain reaction (PCR) assay and high-throughput sequencing have been devised to monitor the frequency of rearrangements between the b-and d-globin paralogs by targeting nucleases.…”

Section: Introductionmentioning

confidence: 99%

High level of fetal-globin reactivation by designed transcriptional activator-like effector

et al. 2020

View full text Add to dashboard Cite

Key Points• TALEs targeted to the g-globin gene promoters reactivated their mRNA expression more than 70-fold with a collateral reduction in b-globin mRNA.• At day 19 of CD34 erythroid differentiation, TALEs increased g-globin more than 40fold in mRNA level and up to 70% of the total globin protein.The fetal-to-adult hemoglobin switch has been a focus of a long-standing effort to potentially treat sickle cell disease and b thalassemia by induction of fetal hemoglobin. In a continuation of this effort, we designed specific transcriptional activator-like effectors (TALEs) to target both the G g and A g-globin promoters. We fused the TALEs to a LIM domain binding protein (Ldb1) dimerization domain, followed by a T2A green fluorescent protein (GFP) cassette, which were assembled into a lentiviral vector. To prevent deletions caused by the repeats of TALEs during the lentivirus packing process, we changed the TALE encoding DNA by codon optimization. Intriguingly, 5 of 14 TALEs showed forced reactivation of fetalglobin expression in human umbilical cord blood-derived erythroid progenitor (HUDEP-2) cells, with a significant increase in the g-globin mRNA level by more than 70-fold. We also observed a more than 50% reduction of b-globin mRNA. High-performance liquid chromatography analysis revealed more than 30% fetal globin in TALE-induced cells compared with the control of 2%. Among several promoters studied, the b-globin gene promoter with the locus control region (LCR) enhancer showed the highest TALE expression during CD34 erythroid differentiation. At day 19 of differentiation, 2 TALEs increased fetalglobin expression more than 40-fold in the mRNA level and up to 70% of the total globin protein. These TALEs have potential for clinical translation.

show abstract

Section: Introductionmentioning

confidence: 99%

High level of fetal-globin reactivation by designed transcriptional activator-like effector

et al. 2020

View full text Add to dashboard Cite

show abstract

“…A similar phenomenon has been shown previously. For example, the same gRNA demonstrated higher efficiency in reducing target gene expression in 293 cells than in pluripotent stem cells (iPSC) and mesenchymal stem cells (MSC) 28 . The used CD44 gRNA was shown to be inefficient in a previous report due to limited Cas9 expression in the system 21 .…”

Section: Discussionmentioning

confidence: 99%

Validation of a CRISPR/cas9-based technology platform for examining specific immune gene functions in an experimental murine model of IBD

Wang

Graham

Sun

et al. 2019

Preprint

View full text Add to dashboard Cite

Inflammatory bowel diseases (IBD) are complex, multifactorial disorders characterized by chronic relapsing intestinal inflammation. Association studies have identified hundreds of genes that are linked to IBD and potentially regulate its pathology. The further dissection of the genetic network underlining IBD pathogenesis and pathophysiology is hindered by the limited capacity to investigate the role of each GWAS association through functional studies, including the generation of knockout animal models for each of the associated genes. The CRISPR/Cas9 system represents a cutting edge technology which has the potential to transform the field of IBD research by facilitating the introduction of genetic alterations in an efficient and effective manner. Using the CD40-mediated-colitis model, our results demonstrate the validity of a CRISPR/Cas9-based platform as a tool for the validation of target genes or interference strategies in experimental IBD. The utilization of this discovery strategy will allow for the timelyin vivovalidation of therapeutic targets as the rapidly emerge from current genetic and genomics efforts with human disease tissue. As such, the CRISPR/Cas9-based platform can significantly shorten the time span between target identification and generation of proof of principle experiments for drug discovery.

show abstract

“…The spacer sequences are as follows: sgLKB1‐1, GATTTTGAGGGTGCCACCGG; sgLKB1‐2, and GTTGCGAAGGATCCCCAACG. The vector cloning and sgRNA design have been detailed elsewhere . The sgLKB1‐1 and sgLKB1‐2 groups are hereinafter referred as to KO1 and KO2, respectively.…”

Section: Methodsmentioning

confidence: 99%

Liver Kinase B1 Fine‐Tunes Lineage Commitment of Human Fetal Synovium‐Derived Stem Cells

Zhou

Zhang

et al. 2019

Journal Orthopaedic Research

View full text Add to dashboard Cite

Liver kinase B1 (LKB1), a serine/threonine protein, is a key regulator in stem cell function and energy metabolism. Herein, we describe the role of LKB1 in modulating the differentiation of synovium-derived stem cells (SDSCs) toward chondrogenic, adipogenic, and osteogenic lineages. Human fetal SDSCs were transduced with CRISPR associated protein 9 (Cas9)-single-guide RNA vectors to knockout or lentiviral vectors to overexpress the LKB1 gene. Analyses including ICE (Inference of CRISPR Edits) data from Sanger sequencing and quantitative polymerase chain reaction (qPCR) as well as Western blot demonstrated successful knockout (KO) or overexpression (OE) of LKB1 in human fetal SDSCs without any detectable side effects in morphology, proliferation rate, and cell cycle. LKB1 KO increased CD146 expression; interestingly, LKB1 OE increased SSEA4 level. The qPCR data showed that LKB1 KO upregulated the levels of SOX2 and NANOG while LKB1 OE lowered the expression of POU5F1 and KLF4. Furthermore, LKB1 KO enhanced, and LKB1 OE inhibited, chondrogenic and adipogenic differentiation potential. However, perhaps due to the inherent inability to achieve osteogenesis, LKB1 did not obviously affect osteogenic differentiation. These data demonstrate that LKB1 plays a significant role in determining human SDSCs' adipogenic and chondrogenic differentiation, which might provide an approach for fine-tuning the direction of stem cell differentiation in tissue engineering and regeneration.

show abstract

Different Effects of sgRNA Length on CRISPR-mediated Gene Knockout Efficiency

Cited by 89 publications

References 52 publications

High level of fetal-globin reactivation by designed transcriptional activator-like effector

High level of fetal-globin reactivation by designed transcriptional activator-like effector

Validation of a CRISPR/cas9-based technology platform for examining specific immune gene functions in an experimental murine model of IBD

Liver Kinase B1 Fine‐Tunes Lineage Commitment of Human Fetal Synovium‐Derived Stem Cells

Contact Info

Product

Resources

About