Different roles of inositol 1,4,5-trisphosphate receptor subtypes in prostaglandin F2α-induced calcium oscillations and pacemaking activity of NRK fibroblasts

Inositol 1,4,5-Trisphosphate Receptor Subtype-Specific Regulation of Calcium Oscillations

“…These IP 3 R3 knockdown effects were similar in COS-7 cells that predominantly express IP 3 R3, suggesting that IP 3 R3 functions as an anti Ca 2+ -oscillatory unit. Almirza et al reported similar results using normal kidney fibroblasts, which expresses IP 3 R1 and IP 3 R3 [39]. When IP 3 R1 or IP 3 R3 are knocked-down, the frequency of prostaglandin F 2α -induced Ca 2+ oscillations is significantly decreased or increased, respectively.…”

“…Additionally, Ca 2+ oscillations are known to encode information in their frequency and amplitude to activate various specific downstream targets [15–17]. Efforts to understand the nature of these “cellular radio signals” started at the same time as Ca 2+ oscillations were discovered and have resulted in a large number of publications [16–18, 22, 28, 30, 32, 35, 37, 39, 42, 47, 56, 60, 83, 100–102], most of which is cell type- and agonist-specific. To determine the associations between (1) stimulus, (2) Ca 2+ oscillation, and (3) activation of a specific downstream cellular process, future studies will have to consider the molecular partners involved in each step.…”

Oncogenic K-Ras suppresses IP3-dependent Ca2+ release through remodeling of IP3Rs isoform composition and ER luminal Ca2+ levels in colorectal cancer cell lines

“…A notable feature of IP 3 R3 is that it is least sensitive to Ca 2+ -dependent inhibition (Hagar et al, 1998). As a result, whereas expression of IP 3 R1 supports regular Ca 2+ oscillations, monophasic Ca 2+ transients are observed in IP 3 R3-expressing cells (Almirza et al, 2010;Hattori et al, 2004;Miyakawa et al, 1999). Indeed, siRNA reduction in IP 3 R3 expression in MCF-7 breast cancer cells transformed Ca 2+ responses from a peak-plateau to a more oscillatory profile (Szatkowski et al, 2010).…”

Epigenetics: DNA demethylation promotes skeletal myotube maturation

“…RNA extraction, reverse transcription, and real‐time PCR were performed as described previously (34). Primer sequences (murine) were Myog ‐FW: 5′‐TCCCAACCCAGGAGATCATTT; Myog ‐RV: 5′‐GCAGATTGTGGGCGTCTGTA; Rpl19‐ F W: 5′‐CCAAT‐GAAATCGCCAATGC and Rpl19‐RV: 5′‐CCCATCCTTGAT‐CAGCTTCCT.…”

“…When studying the effects of high [K + ]‐induced depolarization, the increase in [KCl] was compensated by an equiosmolar reduction of [NaCl]. Dynamic video imaging of fluorescence at 510 nm following 340‐ and 380‐nm excitation wavelengths was performed as described elsewhere (34, 41); successive ratio images ( F 340 /F 380 ) were computed as fast as possible (approximately every 500 ms) and used as a measure for [Ca 2+ ] i .…”