Differential Effects of Growth Factors on Tissue-Engineered Cartilage

Abstract

The effects of four regulatory factors on tissue-engineered cartilage were examined with specific focus on the ability to increase construct growth rate and concentrations of glycosaminoglycans (GAG) and collagen, the major extracellular matrix (ECM) components. Bovine calf articular chondrocytes were seeded onto biodegradable polyglycolic acid (PGA) scaffolds and cultured in medium with or without supplemental insulin-like growth factor (IGF-I), interleukin-4 (IL-4), transforming growth factor-beta1 (TGF-beta1) or platelet-derived growth factor (PDGF). IGF-I, IL-4, and TGF-beta1 increased construct wet weights by 1.5-2.9-fold over 4 weeks of culture and increased amounts of cartilaginous ECM components. IGF-I (10-300 ng/mL) maintained wet weight fractions of GAG in constructs seeded at high cell density and increased by up to fivefold GAG fractions in constructs seeded at lower cell density. TGF-beta1 (30 ng/mL) increased wet weight fractions of total collagen by up to 1.4-fold while maintaining a high fraction of type II collagen (79 plus minus 11% of the total collagen). IL-4 (1-100 ng/mL) minimized the thickness of the GAG-depleted region at the construct surfaces. PDGF (1-100 ng/mL) decreased construct growth rate and ECM fractions. Different regulatory factors thus elicit significantly different chondrogenic responses and can be used to selectively control the growth rate and improve the composition of engineered cartilage.

In vitro stage‐specific chondrogenesis of mesenchymal stem cells committed to chondrocytes

“…In addition, activated growth factors, such as EGF, IGF1, and VEGFs, were significantly manifested in committed MSCs; these growth factors have been reported to modulate the process of osteochondrogenesis (15,44,47). Furthermore, FGF2 and its receptor, FGFR2, were also found to be highly induced during chondrogenesis of committed Kp-hMSCs.…”

“…RT was performed with SuperScript III (Invitrogen) and an oligo(dT) [12][13][14][15][16][17][18] primer. Four microliters of RNA was added into a final volume of 21-l solution containing 10 mM dNTP mix, 10ϫ RT buffer, 25 mM MgCl 2 , 0.1M dithiothreitol, RNase inhibitor, and RNase H. Six microliters of RT product was used for the amplification reaction in a final volume of 50 l, containing 2.5 mM dNTP, 25 mM MgCl 2 , primers specific for each gene (for SOX9, primer 1 [P1] GGCAGCTGTGAACT-GGCCA, and P2 GCACACGGGGAACTTGTCC; for COL2A1, P1 CACGCAGAAGTTCACCAAGAA, and P2 CCTTGCTCCAGGGCCAGC; for aggrecan, P1 TGAG-GAGGGCTGGAACAAGTACC, and P2 GGAGGTGGTA-ATTGCAGGGAACA; for RUNX2, P1 ACCATGGTG-GAGATCATCGC, and P2 CATCAAGCTTCTGTCTGTGC; for ALP, P1 ACGTGGCTAAGAATGTCATC, and P2 CTG-GTAGGCGATGTCCTTA; for osteocalcin, P1 CAT-GAGAGCCCTCACA, and P2 AGAGCGACACCCTAGAC; for osteopontin, P1 CAGAATCTCCTAGCCCCACA, and P2 AACTCCTCGCTTTCCATGTG; and for GAPDH, P1 GCTCTCCAGAACATCATCCCTGCC, and P2 CGTTGT-CATACCAGGAAATGAGCTT), and Taq DNA polymerase (Invitrogen).…”

“…MSCs with the capacity to differentiate into the mesenchymal lineage can be isolated from the bone marrow (10)(11)(12), fat tissue (11), umbilical cord blood (13), and amniotic fluid (14). It has been reported that the chondrogenic abilities of MSCs could be triggered with various growth factors, including transforming growth factor ␤ (TGF␤) and fibroblast growth factor (FGF) (15,16).…”

Differential Morphology and Homogeneity of Tissue-Engineered Cartilage in Hydrodynamic Cultivation with Transient Exposure to Insulin-Like Growth Factor-1 and Transforming Growth Factor-β1

“…We chose IGF-1 and transforming growth factor-b1 (TGF-b1), two of the key stimulating agents in cartilage development, as our model molecules. For each molecule, a minimal concentration was selected from their most commonly reported ranges of effective doses for neocartilage cultivation (IGF-1: 100-300 ng/mL; TGF-b1: 10-30 ng/mL [23][24][25] ). By quantifying the amount of growth factors secreted into culture media and the level of expression of the corresponding surface receptors by cultured cells, we explored a possible mechanism that accounts for the transient phenomenon.…”

Dynamic matrix composition in engineered cartilage with stochastic supplementation of growth factors

“…It has been observed experimentally by several investigators that growth factors play an important role in matrix production and inhibition, but there is limited knowledge about the functional mechanisms associated with these effects. [16][17][18][19][20][21][22] This leads to the present objective which is to explore the influence of growth factors within engineered cartilage by modelling hypothetical characteristics of ECM synthesis.…”