Differential modulation of AMPA receptors by cyclothiazide in two types of striatal neurons

Abstract

The modulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazol-propionate (AMPA) receptor-mediated currents by cyclothiazide was investigated in acutely isolated cells from rat striatum with whole-cell patch-clamp recording. Single-cell reverse transcriptase-polymerase chain reaction (RT-PCR) was used to identify medium spiny and giant aspiny neurons and to determine their AMPA receptor subunit composition mostly in separate experiments. After pretreatment with cyclothiazide, kainate-induced AMPA responses were more strongly potentiated in medium spiny than in giant aspiny neurons; cyclothiazide induced a ninefold leftward shift in the kainate concentration-response curve for medium spiny neurons (not giant aspiny neurons). The EC50s for the cyclothiazide potentiation did not differ substantially between medium spiny neurons and giant aspiny neurons. The recovery of kainate-activated currents from modulation by cyclothiazide was slower for medium spiny neurons than for giant aspiny neurons. Medium spiny neurons expressed GluR-A, GluR-B and GluR-C, but not GluR-D subunits in both flip and flop splice variants. All giant aspiny neurons expressed GluR-A and GluR-D, exclusively in the flop form, half of them also expressed GluR-B and GluR-C. This is in keeping with slow and fast desensitization kinetics in medium spiny neurons and giant aspiny neurons, respectively, and differences in cyclothiazide modulation. The rate of cyclothiazide dissociation from the AMPA receptor, activated by glutamate, was approximately 90 times slower in medium spiny neurons than in giant aspiny neurons. In giant aspiny neurons (not medium spiny neurons) this rate was strongly dependent on the presence of an agonist; 1 mM glutamate increased it 30-fold. Thus, two major cell groups in the striatum display distinct AMPA receptor compositions carrying specific properties of glutamate responses. Excitatory transmission will thus be differentially affected by cyclothiazide-type compounds.

Differential localization of the GluR1 and GluR2 subunits of the AMPA-type glutamate receptor among striatal neuron types in rats

“…Consistent with this, single-cell RT-PCR studies have reported that all striatal projection neurons express GluR2, most express GluR1, but few express significant levels of GluR3, and none express GluR4 Stefani et al, 1998;Vorobjev et al, 2000). A ubiquity of GluR2 in striatal projection neurons is consistent with previous immunohistochemical studies using polyclonal antibodies that recognize GluR2/3 or GluR2/3/4c (Tallaksen-Greene and Albin, 1994;Chen et al, 1996;Bernard et al, 1997).…”

“…Moreover, we found that striato-GPe and striatonigral neuron perikarya appear to contain less amounts of GluR2 than do striato-GPi neuron perikarya. The present study further shows that projection neuron perikarya are less rich in GluR1 than GluR2 protein, as also implied by prior ISHH, RT-PCR and immunolabeling studies, and that only 50-70% of striatal projection neuron perikarya contain GluR1 (Bernard et al, 1996(Bernard et al, ,1997Chen et al, 1996Chen et al, ,1998Stefani et al, 1998;Vorobjev et al, 2000). In contrast to the situation for GluR2, we found that striato-GPe perikarya are richer than striato-GPi perikarya in GluR1.…”

“…One consequence of this would be a tendency of striato-GPe and striatonigral neuron perikarya to have more AMPA receptors without GluR2 in their composition than do striato-GPi perikarya. Moreover, striatoGPi and striatonigral neurons are reported to have a lower flip:flop ratio than striato-GPe neurons (Tallaksen-Greene and Albin et al, 1996;Vorobjev et al, 2000).…”

Excitation of Ventral Tegmental Area Dopaminergic and Nondopaminergic Neurons by Orexins/Hypocretins

“…The cytoplasm was taken for reverse transcription (RT)-PCR as described by Eriksson et al (2001). Protocols of the RT reaction and PCR amplification were similar to those described previously (Vorobjev et al, 2000). A two-round amplification strategy was used in each protocol.…”

“…Primers for the first amplification of calbindin (CB) and neuropeptide Y (NPY) were described by Cauli et al (1997); for the 2 d amplification, the same lower primers were used in combination with CB (sense2, TCCTGCTGCTCTTTCGATGC; size of product was 303 bp) or NPY (sense2, GCTCGTGTGTTTGGGCATTCT; 251 bp). The identity of cDNA sequences was revealed by sequencing the second-round amplification products, performed as described by Vorobjev et al (2000). The thin-walled PCR tubes contained a mixture of first-strand cDNA template (1.1 l), 10ϫ PCR buffer (5 l), 10 pM each of sense and antisense primer, and 200 M each of dNTP, and 2.5 U of Taq polymerase.…”