2019
DOI: 10.7554/elife.50598
|View full text |Cite
|
Sign up to set email alerts
|

Differential requirements for cyclase-associated protein (CAP) in actin-dependent processes of Toxoplasma gondii

Abstract: Toxoplasma gondii contains a limited subset of actin binding proteins. Here we show that the putative actin regulator cyclase-associated protein (CAP) is present in two different isoforms and its deletion leads to significant defects in some but not all actin dependent processes. We observe defects in cell-cell communication, daughter cell orientation and the juxtanuclear accumulation of actin, but only modest defects in synchronicity of division and no defect in the replication of the apicoplast. 3D electron … Show more

Help me understand this report

Search citation statements

Order By: Relevance

Paper Sections

Select...
2
2
1

Citation Types

4
62
0

Year Published

2020
2020
2024
2024

Publication Types

Select...
5
2
1

Relationship

1
7

Authors

Journals

citations
Cited by 57 publications
(66 citation statements)
references
References 71 publications
4
62
0
Order By: Relevance
“…TgStx6 was previously shown to localize to the trans-Golgi apparatus ( 54 ) and was detected by coimmunoprecipitation with TgVps45 by mass spectrometry ( Table S1 ). To determine if such a complex might be also formed and fulfil similar functions in apicomplexans, we engineered the endogenous locus of TgStx6 using the LoxP/U1 RNA destabilization strategy in a DiCre-expressing strain ( 55 57 ). Correct integration, replacement of the 3′ untranscribed region (UTR), and rapamycin-induced DiCre-mediated excision of TgStx6 were analyzed by PCR ( Fig.…”
Section: Resultsmentioning
confidence: 99%
“…TgStx6 was previously shown to localize to the trans-Golgi apparatus ( 54 ) and was detected by coimmunoprecipitation with TgVps45 by mass spectrometry ( Table S1 ). To determine if such a complex might be also formed and fulfil similar functions in apicomplexans, we engineered the endogenous locus of TgStx6 using the LoxP/U1 RNA destabilization strategy in a DiCre-expressing strain ( 55 57 ). Correct integration, replacement of the 3′ untranscribed region (UTR), and rapamycin-induced DiCre-mediated excision of TgStx6 were analyzed by PCR ( Fig.…”
Section: Resultsmentioning
confidence: 99%
“…In Toxoplasma gondii, the IMC "apical cap" comprises the anterior-most ~1 μm of the IMC, just basal to the apical complex. The apical cap appears to be a site at which actin regulators (13) and subcomponents of the parasite invasion machinery concentrate (14). While a number of IMC proteins have been genetically manipulated and evaluated phenotypically, their biochemical functions have been understudied.…”
Section: Introductionmentioning
confidence: 99%
“…DegP2 cKD parasites were constructed by transfecting DiCre parasites 117 , with pU6-Universal carrying the gRNA GCGCTCACAAGACCTCGCTGG (P9 and P10) along with a repair template encoding an HA tag followed by the T. gondii CDPK3 3′-UTR flanked by two loxP sites, and followed by four U1 recognition sites and a DHFR resistance cassette. This repair template was PCR amplified from a custom-built plasmid using the primers P46 and P47.…”
Section: Methodsmentioning
confidence: 99%
“…DiCre/tdTomato parasites were constructed by integrating a tdTomato expression cassette into an intergenic region at position 1487300 on chromosome VI. DiCre parasites 119 were co-transfected with a Cas9-expressing plasmid carrying a gRNA with the sequence GCCGTTCTGTCTCACGATGC 46 and a repair template encoding a TUB1 promotor, tdTomato coding sequence, and the DHFR 3′-UTR, which was amplified from a custom-built plasmid using the primers P44 and P45. tdTomato-positive parasites were selected by FACS, and a clonal population was isolated using limiting dilution and confirmed by flow cytometry.…”
Section: Methodsmentioning
confidence: 99%