Disassembly of All SNARE Complexes by N-Ethylmaleimide-sensitive Factor (NSF) Is Initiated by a Conserved 1:1 Interaction between α-Soluble NSF Attachment Protein (SNAP) and SNARE Complex*

Vivona, Sandro; Cipriano, Daniel J.; O’Leary, Seán E.; Li, Ye Henry; Fenn, Timothy D.; Brunger, Axel T.

doi:10.1074/jbc.m113.489807

Cited by 40 publications

(55 citation statements)

References 34 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…2A). This value agrees closely with the reported value of K d ϭ 470 nM by biolayer interferometry (15). A model in which three ␣SNAP molecules bind to a single SC with three distinct binding sites and binding affinities did not provide a significantly better fit to the binding data despite the additional fitting parameters.…”

Section: Resultssupporting

confidence: 81%

“…Indeed, all published structural analyses, including chemical cross-linking, mass spectrometry, and electron microscopy, suggest that three copies of ␣SNAP are present in the 20 S complex (17)(18)(19)(20)(21). It is possible that, although there is only one detectable binding site for ␣SNAP on the SC, there are much weaker binding sites that are not detected in the assays used here or used previously (15). In any case, the kinetic titration analyses presented here (Figs.…”

Section: Discussionmentioning

confidence: 79%

“…Multiple ␣SNAP Molecules Are Required for SNARE Complex Disassembly-Recent biophysical data show that ␣SNAP forms a 1:1 complex with a variety of SNARE complexes lacking membrane anchors (15) (Fig. 2A), a surprising result given prior …”

Section: Resultsmentioning

confidence: 99%

“…␣SNAP binds to NSF in an ATP-dependent manner and accelerates the ATPase activity of NSF (12)(13)(14). ␣SNAP is ubiquitously expressed and binds to all ternary SNARE complexes as well as binary complexes containing only t-SNAREs (15). The crystal structure of the yeast ␣SNAP homolog shows that the protein is an ␣-helical solenoid that is capped by a C-terminal globular helical domain (16).…”

mentioning

confidence: 99%

“…1A). In the absence of NSF, ␣SNAP binds to the neuronal SNARE complex lacking transmembrane anchors in a 1:1 stoichiometry (15).…”

mentioning

confidence: 99%

See 4 more Smart Citations

Three αSNAP and 10 ATP Molecules Are Used in SNARE Complex Disassembly by N-ethylmaleimide-sensitive Factor (NSF)

Shah

Colbert

Enos

et al. 2015

Journal of Biological Chemistry

View full text Add to dashboard Cite

Background:The ATPase NSF works with the adaptor protein ␣SNAP to disassemble SNARE protein complexes involved in membrane fusion.Results: Kinetic assays demonstrate that three ␣SNAP and 10 ATP molecules are required to disassemble a SNARE complex. Conclusion:The energy requirements and functional stoichiometry of ␣SNAP in SNARE complex disassembly are established. Significance:The results suggest models of NSF action.

show abstract

Section: Resultssupporting

confidence: 81%

Section: Discussionmentioning

confidence: 79%

Section: Resultsmentioning

confidence: 99%

mentioning

confidence: 99%

“…1A). In the absence of NSF, ␣SNAP binds to the neuronal SNARE complex lacking transmembrane anchors in a 1:1 stoichiometry (15).…”

mentioning

confidence: 99%

See 3 more Smart Citations

Three αSNAP and 10 ATP Molecules Are Used in SNARE Complex Disassembly by N-ethylmaleimide-sensitive Factor (NSF)

Shah

Colbert

Enos

et al. 2015

Journal of Biological Chemistry

View full text Add to dashboard Cite

show abstract

Association of Alpha-Soluble NSF Attachment Protein with Epileptic Seizure

Deng

Wang

et al. 2015

J Mol Neurosci

View full text Add to dashboard Cite

Alpha-soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein (αSNAP) is a ubiquitous and indispensable component of membrane fusion machinery. There is accumulating evidence that mild alterations of αSNAP expression may be associated with specific pathological conditions in several neurological disorders. This study aimed to assess αSNAP expression in temporal lobe epilepsy (TLE) patients and pilocarpine-induced rat model and to determine whether altered αSNAP expression leads to increased susceptibility to seizures. The expression of αSNAP was assessed in the temporal lobe from patients with TLE and pilocarpine-induced epileptic rats. In addition, αSNAP expression was silenced by lentivirus pLKD-CMV-GFP-U6-NAPA (primer: GGAAGCATGCGAGATCTATGC) in animals. At day 7, the animals were kindled by pilocarpine and then the time of latency to seizure and the incidence of chronic idiopathic epilepsy seizures were assessed. The immunoreactivity to alpha-SNAP was utilized to measure expression of this protein in the animal. By immunohistochemistry, immunofluorescence, and western blotting, we found significantly lower αSNAP levels in patients with TLE. αSNAP expression showed no obvious change in pilocarpine-induced epileptic rats, from 6 h to 3 days after seizure, compared with the control group, in the acute stage; however, αSNAP levels were significantly lower in the chronic phase (day 7, months 1 and 2) in epileptic rats. Importantly, behavioral data revealed that αSNAP-small interfering RNA (siRNA) could decrease the time of latency to seizure and increase the incidence of chronic idiopathic epilepsy seizures compared with the control group. αSNAP is mainly expressed in the neuron brain tissue of patients with TLE and epileptic animals. Our findings suggest that decreasing αSNAP levels may increase epilepsy susceptibility, providing a new strategy for the treatment of this disease.

show abstract

Hidden Markov Modeling with Detailed Balance and Its Application to Single Protein Folding

Zhang

Jiao

Rebane

2016

Biophysical Journal

View full text Add to dashboard Cite

Hidden Markov modeling (HMM) has revolutionized kinetic studies of macromolecules. However, results from HMM often violate detailed balance when applied to the transitions under thermodynamic equilibrium, and the consequence of such violation has not been well understood. Here, to our knowledge, we developed a new HMM method that satisfies detailed balance (HMM-DB) and optimizes model parameters by gradient search. We used free energy of stable and transition states as independent fitting parameters and considered both normal and skew normal distributions of the measurement noise. We validated our method by analyzing simulated extension trajectories that mimicked experimental data of single protein folding from optical tweezers. We then applied HMM-DB to elucidate kinetics of regulated SNARE zippering containing degenerate states. For both simulated and measured trajectories, we found that HMM-DB significantly reduced overfitting of short trajectories compared to the standard HMM based on an expectation-maximization algorithm, leading to more accurate and reliable model fitting by HMM-DB. We revealed how HMM-DB could be conveniently used to derive a simplified energy landscape of protein folding. Finally, we extended HMM-DB to correct the baseline drift in single-molecule trajectories. Together, we demonstrated an efficient, versatile, and reliable method of HMM for kinetics studies of macromolecules under thermodynamic equilibrium.

show abstract

Disassembly of All SNARE Complexes by N-Ethylmaleimide-sensitive Factor (NSF) Is Initiated by a Conserved 1:1 Interaction between α-Soluble NSF Attachment Protein (SNAP) and SNARE Complex*

Cited by 40 publications

References 34 publications

Three αSNAP and 10 ATP Molecules Are Used in SNARE Complex Disassembly by N-ethylmaleimide-sensitive Factor (NSF)

Three αSNAP and 10 ATP Molecules Are Used in SNARE Complex Disassembly by N-ethylmaleimide-sensitive Factor (NSF)

Association of Alpha-Soluble NSF Attachment Protein with Epileptic Seizure

Hidden Markov Modeling with Detailed Balance and Its Application to Single Protein Folding

Contact Info

Product

Resources

About