Dissection, Culture, and Analysis of <em>Xenopus laevis</em> Embryonic Retinal Tissue

Abstract

The process by which the anterior region of the neural plate gives rise to the vertebrate retina continues to be a major focus of both clinical and basic research. In addition to the obvious medical relevance for understanding and treating retinal disease, the development of the vertebrate retina continues to serve as an important and elegant model system for understanding neuronal cell type determination and differentiation [1][2][3][4][5][6][7][8][9][10][11][12][13][14][15][16] . The neural retina consists of six discrete cell types (ganglion, amacrine, horizontal, photoreceptors, bipolar cells, and Müller glial cells) arranged in stereotypical layers, a pattern that is largely conserved among all vertebrates 12,[14][15][16][17][18] .While studying the retina in the intact developing embryo is clearly required for understanding how this complex organ develops from a protrusion of the forebrain into a layered structure, there are many questions that benefit from employing approaches using primary cell culture of presumptive retinal cells 7,[19][20][21][22][23] . For example, analyzing cells from tissues removed and dissociated at different stages allows one to discern the state of specification of individual cells at different developmental stages, that is, the fate of the cells in the absence of interactions with neighboring tissues 8,[19][20][21][22][24][25][26][27][28][29][30][31][32][33] . Primary cell culture also allows the investigator to treat the culture with specific reagents and analyze the results on a single cell level 5,8,21,24,[27][28][29][30][33][34][35][36][37][38][39] . Xenopus laevis, a classic model system for the study of early neural development 19,27,29,[31][32][40][41][42] , serves as a particularly suitable system for retinal primary cell culture 10,38,[43][44][45] .Presumptive retinal tissue is accessible from the earliest stages of development, immediately following neural induction 25,38,43 . In addition, given that each cell in the embryo contains a supply of yolk, retinal cells can be cultured in a very simple defined media consisting of a buffered salt solution, thus removing the confounding effects of incubation or other sera-based products 10,24,[44][45] .However, the isolation of the retinal tissue from surrounding tissues and the subsequent processing is challenging. Here, we present a method for the dissection and dissociation of retinal cells in Xenopus laevis that will be used to prepare primary cell cultures that will, in turn, be analyzed for calcium activity and gene expression at the resolution of single cells. While the topic presented in this paper is the analysis of spontaneous calcium transients, the technique is broadly applicable to a wide array of research questions and approaches (Figure 1). Video LinkThe video component of this article can be found at

MarvelD3 regulates the c-Jun N-terminal kinase pathway during eye development in Xenopus

“…To determine xMD3 expression, total RNA from 40 optic vesicles [stage 25; without staining as described in McDonough et al (2012)] and 50 eyes (stage 42; removal of epidermis in rostro-caudal manner and eye isolation) was extracted following the manufacturer instructions (RNeasy mini kit, Qiagen) and a semi-quantitative PCR was performed for MD3 and GAPDH, with the following primers respectively: MD3 Fw, ACAATGAGAGATTCTGTTACAGACGGGG; MD3 Rv, AAGCTCCCAACAGTTACAGCATCCATGGCT; GAPDH Fw, ACTGCCACCCAGAAGAC; GAPDH Rv, AAGTGCTTATTCCTTAGATG.…”

Temporal Transcriptomic Profiling of the DevelopingXenopus laevisEye

“…Each stage was collected in triplicates (n = 3) and each biological replicate was composed of pooled eye tissues from 20–30 animals/embryos. Eye ablation and tissue dissociation was performed in Liberase (Thermolysin Medium Research Grade, Roche, Indianapolis, IN) and/or calcium-magnesium free Modified Ringer solution (CMF-MR) (adapted from [ 81 ]). Dissociated tissues were immediately stored in TRIzol Reagent (Invitrogen, Carlsbad, CA) at −80°C.…”

The role of voltage‐gated calcium channels in neurotransmitter phenotype specification: Coexpression and functional analysis in Xenopus laevis

“…Whereas xVIAAT was selected as a general inhibitory neural marker in whole-mount coexpression experiments, the specifically GABAergic probe xGAD67 was selected for cell culture experiments because previous studies have demonstrated that calcium spike frequency regulates xGAD67 expression in vitro (Watt et al, 2000 ). High-stringency FISH was performed on cell cultures using an anti-digoxigenin peroxidase antibody (Roche) and fluorescein–tyramide as the color substrate, following the protocol of Davidson and Keller ( 1999 ) with minor modifications as outlined by McDonough et al ( 2012 ). Sense probes were used to determine background level of fluorescence.…”