Distinct temporal recruitment of Plasmodium alveolins to the subpellicular network

Abstract

The zoite stages of malaria parasites (merozoite, ookinete and sporozoite) possess a distinctive cortical structure termed the pellicle, which is defined by a double membrane layer named the inner membrane complex (IMC). The IMC is supported by a cytoskeleton of intermediate filaments, termed the subpellicular network (SPN). Plasmodium IMC1 proteins, or alveolins, make up a conserved family of structurally related proteins that comprise building blocks of the SPN. Here, using green fluorescent protein (GFP) tagging in P. berghei, we show that the alveolins PbIMC1c and PbIMC1e are expressed in all three zoite stages. Our data reveal that PbIMC1e is assembled into the SPN concurrent with pellicle development, while PbIMC1c is assembled after pellicle formation. In the sexual stages, these processes are accompanied by different gene expressions from maternal and paternal alleles: PbIMC1e is expressed uniquely from the maternal allele, while PbIMC1c is expressed from the maternal allele in gametocytes, but from both parental alleles during ookinete development. These findings establish biogenesis of the cortical cytoskeleton in Plasmodium to be a complex and dynamic process, involving distinct parental gene expression and chronological recruitment of its protein constituents. While allelic replacement of the pbimc1c and pbimc1e genes with GFP-tagged versions was readily achieved using double crossover homologous recombination, attempts to disrupt these genes by this strategy only resulted in the integration of the selectable marker and GFP reporter into non-specific genomic locations. The recurrent inability to disrupt these genes provides the first genetic evidence that alveolins are necessary for asexual blood-stage parasite development in Plasmodium.

The Plasmodium alveolin IMC1a is stabilised by its terminal cysteine motifs and facilitates sporozoite morphogenesis and infectivity in a dose-dependent manner

“…Fitting with the nature of structural proteins, this finding suggests that the relative abundance of an alveolin in the cell may determine its relative contribution to the cortical cytoskeleton. In support of this concept, it is perhaps not a coincidence that knockout of the ookinete-expressed alveolin IMC1d has no detectable phenotype, and also has the lowest expression level of all ookinete-expressed alveolins examined by us [7], [9], [10], [16]. Just a fraction of IMC1a (10–21% of WT level in Mutant 1 and Mutant 2) is sufficient to partially restore the phenotype of IMC1a null mutant parasites (Fig.…”

“…To allow mCherry tagging of IMC1a, an approximately 3.5 kb fragment corresponding to the entire imc1a gene (introns included) plus 5′-UTR was PCR amplified from P. berghei gDNA using primers pDNR-imc1a-F (ACGAAGTTATCAGTCGAGGTACCTTTCATGATTCTATCTATTGTTAATTTTAATTG) and pDNR-imc1a-R (ATGAGGGCCCCTAAGCTTTTATCTTGATTACAAAAATAATTACAACATTTG) and introduced into SalI/HindIII-digested pDNR-mCherry [16] by in-fusion to give plasmid pDNR-IMC1a/mCherry (Fig. S1).…”

Palmitoylation of Plasmodium alveolins promotes cytoskeletal function

“…Accordingly, palmitoylation would not occur until after SPN recruitment/IMC targeting of the alveolin. Contrary to IMC1a that is recruited to the SPN concomitant with pellicle formation [5], IMC1c is recruited late to the SPN after pellicle formation and zoite morphogenesis has happened [21]. By implication, palmitoylation of IMC1c in the blood stages would not take place until completion of cytokinesis in the schizonts, which could explain why 2-BMP is so effective at blocking this step.…”

Towards genome-wide experimental genetics in thein vivomalaria model parasitePlasmodium berghei

“…89 Using a comparable strategy but an alternative transfection vector system, 90,91 the distinct spatio-temporal distribution of two alveolins was visualised. 92 Refractoriness to gene-deletion in combination with accessibility of the loci provided convincing evidence for essential functions during asexual blood-stage development, while conversely the efficient establishment of a blood infection following the endogenous tagging of the proteins leans support to the correct localisation and functionality of these GFP-tagged proteins. This may be further confirmed by assuring that parasite growth rates and protein integrity also remain unaltered.…”