Distinctive features of the respiratory syncytial virus priming loop compared to other non-segmented negative strand RNA viruses

Abstract

De novo initiation by viral RNA-dependent RNA polymerases often requires a polymerase priming residue, located within a priming loop, to stabilize the initiating NTPs. Polymerase structures from three different non-segmented negative strand RNA virus (nsNSV) families revealed putative priming loops in different conformations, and an aromatic priming residue has been identified in the rhabdovirus polymerase. In a previous study of the respiratory syncytial virus (RSV) polymerase, we found that Tyr1276, the L protein aromatic amino acid residue that most closely aligns with the rhabdovirus priming residue, is not required for RNA synthesis but two nearby residues, Pro1261 and Trp1262, were required. In this study, we examined the roles of Pro1261 and Trp1262 in RNA synthesis initiation. Biochemical studies showed that substitution of Pro1261 inhibited RNA synthesis initiation without inhibiting back-priming, indicating a defect in initiation. Biochemical and minigenome experiments showed that the initiation defect incurred by a P1261A substitution could be rescued by factors that would be expected to increase the stability of the initiation complex, specifically increased NTP concentration, manganese, and a more efficient promoter sequence. These findings indicate that Pro1261 of the RSV L protein plays a role in initiation, most likely in stabilizing the initiation complex. However, we found that substitution of the corresponding proline residue in a filovirus polymerase had no effect on RNA synthesis initiation or elongation. These results indicate that despite similarities between the nsNSV polymerases, there are differences in the features required for RNA synthesis initiation.

Conserved allosteric inhibitory site on the respiratory syncytial virus and human metapneumovirus RNA-dependent RNA polymerases

“…To distinguish between an effect on initiation versus early elongation, the compound was tested in an in vitro assay designed to examine effects on RNA synthesis from position 3C of the promoter 41 . Reactions were performed by preincubating full-length RSV L-P complexes with different concentrations of MRK-1 and then initiating reactions by adding an RNA oligonucleotide representing nucleotides 1–14 of the RSV trailer promoter, and ATP, UTP, and GTP, with radiolabeled GTP included as a tracer (Fig.…”

“…Reactions to detect RNA synthesis products generated from position 3 of the tr promoter were performed with the following conditions: L-P complexes containing 300 ng RSV L or RSV L trunc were incubated in 25 µL reactions containing 50 mM Tris pH 7.5, 8 mM MgCl 2 , 5 mM DTT, 10% glycerol, 2 μM RNA oligonucleotide RSV tr 1-14 (Dharmacon), 500 μM each of ATP and UTP, and 10 µM GTP with 5 μCi [α- 32 P] GTP (3000 Ci/mmol) 41 . To analyze dinucleotide formation and elongation products in the presence of MRK-1, DMSO or various concentrations of inhibitor diluted in DMSO were included in the reaction mixtures.…”

“…Typically, 3 fractions of ladder were pooled together after determining which would give an evenly distributed ladder once combined. The ladder for the pppGpA dinucleotide was prepared using T7 RNA polymerase 41 . DNA oligonucleotides 5′ TCTATAGTGAGTCCGTATTA and 5′ TAATACGACTCACTATA were annealed to each other by mixing 4 μM of each oligonucleotide in Tris-EDTA pH 8.0, incubating at 90 ˚C for 3 min, then cooling to room temperature.…”

“…RNAs initiated at positions 1U and 3C were detected using a 32 P end-labeled primer with the sequence 5′ TTTGGTTTATGCAAGTTTGTTGTAC corresponding to nucleotides 15–39 of the leader region. These primer extension reactions were performed using 0.2 µM primer, 500 µM each dNTP, and Sensiscript reverse transcriptase (Qiagen), according to manufacturer’s instructions 41 . Products were migrated on a 6% polyacrylamide 7 M urea gel in Tris-borate-EDTA buffer alongside markers consisting of 32 P end-labeled DNA oligonucleotides corresponding to the length and sequence of cDNA representing RNA initiated at position 1U or 3C (39-nt or 37-nt, respectively).…”

Analysis of Template Variations on RNA Synthesis by Respiratory Syncytial Virus Polymerase

“…Alternatively, transcription initiates at position +3 of the Le promoter. The +3 initiation at the TrC promoter only generates short (less than 25 nts) transcripts [ 18 , 19 , 20 , 21 , 22 ]. Fearns group demonstrated that the initiating nucleotides are loaded into RdRp independently of the template [ 23 , 24 ].…”