Distribution of Intervening Sequences in the Genes for 23S rRNA and rRNA Fragmentation among Strains of the Salmonella Reference Collection B (SARB) and SARC Sets

Abstract

Intervening sequences (IVSs) occur sporadically in several bacterial genera in the genes for 23S rRNA at relatively conserved locations. They are cleaved after transcription and lead to the presence of fragmented rRNA, which is incorporated into the ribosomes without religation but is nevertheless functional. The fragmentation of rRNA and the number of IVSs in all 72 strains of the Salmonella Reference Collection B set and 16 strains of the Salmonella Reference Collection C set, which have been established on the basis of multilocus enzyme electrophoresis (MLEE), were analyzed in the present study. Fragmentation of 23S rRNA was restricted to conserved cleavage sites located at bp 550 (helix 25) and bp 1170 (helix 45), locations where IVSs have been reported. Random cleavage at sites where IVSs could not be detected was not seen. Uncleaved IVSs were not detected in any case; thus, the IVSs invariably led to rRNA fragmentation, indicating a strong selection for maintenance of RNase III cleavage sites. The distribution of the number of IVSs carried by the different strains in the seven rrl genes is diverse, and the pattern of IVS possession could not be related to the MLEE pattern among the various Salmonella strains tested; this indicates that the IVSs are frequently exchanged between strains by lateral transfer. All eight subspecies of the genus Salmonella, including subspecies V represented by Salmonella bongori, have IVSs in both helix 25 and helix 45; this indicates that IVSs entered the genus after its divergence from Escherichia coli (more than 100 million years ago) but before separation of the genus Salmonella into many forms or that they were in the ancestor but have been lost from Escherichia.

Determining RNA quality for NextGen sequencing: some exceptions to the gold standard rule of 23S to 16S rRNA ratio§

“…On the other hand, a higher molecular weight amplicon (~830 bp) was generated from those rrl loci which harbored IVSs (Figure 1). Our PCR data corroborates earlier reported IVSs in helix-25 and helix-45 positions [12]. As expected, RNA from Salmonella strains which do not carry IVSs in either of the helixes such as serovar Montevideo strain SARB-30, serovar Panama strain SARB-40, and serovar Paratyphi A strain SARB-42 (Figure 1, lanes 9-14) [12], gave high RNA integrity scores and high 23S/16S ratios on both microfluidic platforms ( Table 1, samples 6-8).…”

“…In some Salmonella strains, IVSs occur at helix-25 and helix-45 positions and may vary in numbers [12]. Salmonella and E. coli carry total seven ribosomal RNA synthesis genes (rrl) per chromosome and in each Salmonella enterica strain the occurrence of IVSs across all rrl genes within a chromosome is highly variable.…”

“…PCR probes were designed for helix-25 rrlH-F1 (5'GCGCCGGTAAGGTGATATG 3') and rrlH-R1 (5' GCTATCTCCCGGTTTGATTG 3') and helix-45 rrlH-F2 (5'CCGATGCAAACTGCGAATAC 3') and rrlH-R2 (5' TTCTCTACCTGACCACCTG 3') intervening sequences [12]. These primers are located in the rrlH gene (NC_016810.1, at positions 291299 and 292227) of S. enterica serovar Typhimurium strain SL 1344.…”

Frequent recombination and low level of clonality within Salmonella enterica subspecies I

“…The MLEE tree of SARB has been widely used to represent the strain phylogeny of these strains (Pabbaraju et al, 2000;Torpdahl & Ahrens, 2004). Although we can only make a comparison of 15 of the 72 strains, no consistency of clustering of strains was observed between the MLEE tree and the combined sequence tree (Fig.…”

Intervening Sequences in rrl Genes and Fragmentation of 23S rRNA in Genera of the Family Enterobacteriaceae

“…IVSs have been observed in 14 different genera of bacteria, including Rhodopseudomonas (5), Agrobacterium (8), Brucella (8), and Rhizobium (26) (alpha group of Proteobacteria, defined by 16S rRNA sequence) (32), Coxiella (1), Actinobacillus (7), Haemophilus (29), Salmonella (3,17) (21), Proteus (20), Providencia (20), and Yersinia (27) (gamma group of Proteobacteria), and Campylobacter (10) and Helicobacter (9) (epsilon group of Proteobacteria), as well as Leptospira (23) (spirochetes).…”