Distribution of sulfate-reducing bacteria in a stratified fjord (Mariager Fjord, Denmark) as evaluated by most-probable-number counts and denaturing gradient gel electrophoresis of PCR-amplified ribosomal DNA fragments

Abstract

The sulfate-reducing bacterial populations of a stratified marine water column, Mariager Fjord, Denmark, were investigated by molecular and culture-dependent approaches in parallel. Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified 16S rRNA and DNA encoding rRNA (rDNA) isolated from the water column indicated specific bacterial populations in different water column layers and revealed a highly differentiated pattern of rRNA-and rDNA-derived PCR amplificates, probably reflecting active and resting bacterial populations. Hybridization of DGGE patterns with rRNA probes indicated the increased presence and activity (by at least 1 order of magnitude) of sulfate-reducing bacteria within and below the chemocline. Parallel to this molecular approach, an approach involving most-probable-number (MPN) counts was used, and it found a similar distribution of cultivable sulfate-reducing bacteria in the water column of Mariager Fjord, Approximately 25 cells and 250 cells per ml above and below the chemocline, respectively, were found. Desulfovibrioand Desulfobulbus-related strains occurred in the oxic zone. DGGE bands from MPN cultures were sequenced and compared with those obtained from nucleic acids extracted from water column samples. The MPN isolates were phylogenetically affiliated with sulfate-reducing delta subdivision proteobacteria (members of the genera Desulfovibrio, Desulfobulbus, and Desulfobacter), whereas the molecular isolates constituted an independent lineage of the delta subdivision proteobacteria. DGGE of PCR-amplified nucleic acids with general eubacterial PCR primers conceptually revealed the general bacterial population, whereas the use of culture media allowed cultivable sulfate-reducing bacteria to be selected. A parallel study of Mariager Fjord biogeochemistry, bacterial activity, and bacterial counts complementing this investigation has been presented elsewhere (N. B.

Methylmercury production in high arctic wetlands

“…The amount of SRB recovered using the MPN technique was low relative to other extreme environments, such as acid mine drainage tails (10 6 ) [36]. The SRB populations determined with MPN techniques are often three orders of magnitude lower than those estimated with molecular techniques [37]; however, in the present study, this was not the case. The DSR gene specific for SRB was only amplified at one site, which did not have high culturable SRB or MeHg relative to other sites.…”

Biased 16S rDNA PCR amplification caused by interference from DNA flanking the template region

“…The forward and reverse primers used were: 515F (5PGTGCCAGCAGCCGCGGTAA3P) and 1408R (5PTGACGGGCGGTGTGTACAAGGC3P) targeting conserved regions 515^533 and 1408^1387 (IUB nomenclature for Escherichia coli [13]); GM5F (5PCCTACGGGAGGCAGCAG3P) and DS907R (5PCCCCGTCAATTCCTTTGAGTTT3P) [14] targeting conserved regions 341^357 and 928^907; 9F (5PGAGTTTGATCCTGGCTCAG3P) and 1512R (5PACGGCTACCTTGTTACGACTT3P) targeting conserved regions 9^27 and 1512^1492. The primers used were purchased from Hobolth DNA Syntese.…”

Transcriptional analysis of sulfate reducing and chemolithoautotrophic sulfur oxidizing bacteria in the deep subseafloor

“…Sulfate reduction coupled to organic matter oxidation is an important mechanism of diagenesis in marine sediment (Froelich et al, 1979;D'Hondt et al 2004). Functional (Leloup et al, 2006;Lever, 2012) and taxonomic (Teske et al, 1996;Hubert et al, 2009;A€ ullo et al, 2013) gene surveys frequently detect the presence of sulfate reducing bacteria (SRB) in shallow, anoxic marine sediment.…”