Diversity, biology and evolution of IncQ-family plasmids

Loftie-Eaton, Wesley; Rawlings, Douglas E.

doi:10.1016/j.plasmid.2011.10.001

Cited by 85 publications

(77 citation statements)

References 72 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…mobC, mobA/B, and an OriT-containing sequence were adjacent to the replication control region. Mob proteins are involved in IncQ mobilization, which, like that seen with the IncI harbored by EL231, is facilitated by coexisting selftransferable plasmids (14,15).…”

mentioning

confidence: 99%

“…1A). Additionally, the fact that IncQ plasmids remain in a singlestranded status during complementary-strand synthesis (15) favors the recombination hypothesis. This is the first description of carriage by an IncQ plasmid of a bla CMY-2 -type gene, underscoring the mobilization potential of these resistance determinants.…”

mentioning

confidence: 99%

“…This is the first description of carriage by an IncQ plasmid of a bla CMY-2 -type gene, underscoring the mobilization potential of these resistance determinants. Notably, IncQ plasmids can be established in hosts belonging to distant taxa inhabiting various ecosystems (15,18). This development may contribute to the persistence and further dissemination of the bla CMY genes.…”

mentioning

confidence: 99%

See 2 more Smart Citations

Characterization of a Mobilizable IncQ Plasmid Encoding Cephalosporinase CMY-4 in Escherichia coli

Kotsakis

Tzouvelekis

Lebessi

et al. 2015

Antimicrob Agents Chemother

View full text Add to dashboard Cite

mentioning

confidence: 99%

mentioning

confidence: 99%

mentioning

confidence: 99%

See 1 more Smart Citation

Characterization of a Mobilizable IncQ Plasmid Encoding Cephalosporinase CMY-4 in Escherichia coli

Kotsakis

Tzouvelekis

Lebessi

et al. 2015

Antimicrob Agents Chemother

View full text Add to dashboard Cite

“…KX539265), was found to be 7, 831 bp in length. The backbone of pVPS72-VEB was found to be similar to that of small, broad-host-range, IncQ-like plasmids with sizes of 5.1 to 14.2 kb (9). A BLASTn search of the nr database for the bla VEB-18 gene cassette indicated that it is a novel gene cassette and the bla VEB -aadB gene fragment could be found in different integrons in the NCBI database.…”

mentioning

confidence: 93%

“…1) (11). It has been reported that IncQ plasmids are highly mobilizable with the help of large conjugative plasmids and are able to nonselectively capture resistance genes in the environment (9). The pVAS24-VEB plasmid was transferrable in a conjugation assay; however, no transconjugant could be harvested for pVPS72-VEB.…”

mentioning

confidence: 99%

Genetic Characterization of Broad-Host-Range IncQ Plasmids Harboring bla _VEB-18 in Vibrio Species

Ye²,

Zheng³

et al. 2017

Antimicrob Agents Chemother

View full text Add to dashboard Cite

The dissemination of genetic elements encoding VEB-type ␤-lactamases among Gram-negative bacteria has become a public health concern worldwide (1, 2). Recently, a bla VEB-2 gene was detected in a novel plasmid in Vibrio parahaemolyticus, an important foodborne pathogen causing gastroenteritis in humans (3, 4). Following our previous study (4), we investigated the genetic features of a novel bla VEB-18 variant in V. parahaemolyticus and Vibrio alginolyticus, both of which belong to the Vibrio harveyi clade.Isolates of V. parahaemolyticus VPS72 and V. alginolyticus VAS24 were obtained from shrimp samples in supermarkets in Shenzhen, China, in 2015. These two isolates were shown to be resistant to cephalosporin antibiotics by determination of the MICs by the broth microdilution method in accordance with the CLSI standard (5). PCR assays performed as previously described identified a bla VEB -type extended-spectrum ␤-lactamase (ESBL)-encoding gene in these two isolates (6). The full length of bla VEB alleles was amplified with primers VEB-F (ATGAAAATCGTAAAAAGGAT) and VEB-R (TTATTTATTCAAATAGTAAT) and sequenced by the Sanger method. Sequences of the bla VEB PCR products obtained from VPS72 and VAS24 showed that they belong to a new bla VEB variant, the deduced amino acid sequence of which revealed the presence of three substitutions (V 19 A, T 104 M, and N 294 D) compared with VEB-1. We designated this new bla VEB allele bla VEB-18 (accession no. NG_051319). To check for the activity of the novel ␤-lactamase, VEB-18, the entire coding sequence of VEB-18 was amplified with primers VEB18-F (GAGAAGATCATCACCA) and VEB-R (TTATTTATTCAAATAGTAAT), purified, and cloned into the pCR2.1-TOPO vector to obtain pCR2.1-bla . Escherichia coli DH5␣ carrying pCR2.1-bla VEB-18 and pCR2.1-bla VEB-2 exhibited similar cefotaxime, ceftazidime, and ceftriaxone MICs of 8 to 16 mg/liter, suggesting that this variant exhibits activity similar to that of VEB-2.A conjugation experiment performed as previously described (7) showed that the bla VEB-18 gene in V. parahaemolyticus VAS24 was transferred to E. coli J53 (Az r ), whereas the cephalosporin resistance phenotype encoded by the bla VEB-18 gene in V. alginolyticus VPS72 could not be transferred to E. coli J53. However, the gene could be transferred to E. coli TG1 through electroporation. S1 pulsed-field gel electrophoresis (PFGE) analysis of VPS72, VAS24, and their corresponding transformant/transconjugant strains showed that one of the parental strains, VAS24, contained one plasmid of ϳ240 kb, yet no plasmid was observed in the other three strains. A Southern hybridization experiment showed that the bla VEB-18 probe could not be positively hybridized to either the chromosome or plasmids in these strains. These data suggested that the bla VEB-18 allele may be harbored by small plasmids that could not be detected by S1 PFGE and These plasmids were subjected to Illumina sequencing and then de novo assembly by SPAdes 3.5 (8). The bla VEB -bearing contigs were circularized by the primer-walking ...

show abstract

References

2020

Structure and Function of the Bacterial Genome

View full text Add to dashboard Cite

Diversity, biology and evolution of IncQ-family plasmids

Cited by 85 publications

References 72 publications

Characterization of a Mobilizable IncQ Plasmid Encoding Cephalosporinase CMY-4 in Escherichia coli

Characterization of a Mobilizable IncQ Plasmid Encoding Cephalosporinase CMY-4 in Escherichia coli

Genetic Characterization of Broad-Host-Range IncQ Plasmids Harboring bla _VEB-18 in Vibrio Species

References

Contact Info

Product

Resources

About

Diversity, biology and evolution of IncQ-family plasmids

Cited by 85 publications

References 72 publications

Characterization of a Mobilizable IncQ Plasmid Encoding Cephalosporinase CMY-4 in Escherichia coli

Characterization of a Mobilizable IncQ Plasmid Encoding Cephalosporinase CMY-4 in Escherichia coli

Genetic Characterization of Broad-Host-Range IncQ Plasmids Harboring bla VEB-18 in Vibrio Species

References

Contact Info

Product

Resources

About

Genetic Characterization of Broad-Host-Range IncQ Plasmids Harboring bla _VEB-18 in Vibrio Species