Diversity of the trifunctional histidine biosynthesis gene (his) in cerealPhaeosphaeriaspecies

Abstract

Phaeosphaeria species are important causal agents of Stagonospora leaf blotch diseases in cereals. In this study, the nucleotide sequence and deduced polypeptide of the trifunctional histidine biosynthesis gene (his) are used to investigate the phylogenetic relationships and provide molecular identification among cereal Phaeosphaeria species. The full-length sequences of the his gene were obtained by PCR amplification and compared among cereal Phaeosphaeria species. The coding sequence of the his gene in wheat-biotype P. nodorum (PN-w) was 2697 bp. The his genes in barley-biotype P. nodorum (PN-b), two P. avenaria f. sp. triticea isolates (homothallic Pat1 and Pat3), and Phaeosphaeria species from Polish rye and dallis grass were 2694 bp. The his gene in heterothallic isolate Pat2, however, was 2693 bp because the intron had one fewer base. In P. avenaria f. sp. avenaria (Paa), the his gene was only 2670 bp long. The differences in the size of the his gene contributed to the variation in amino acid sequences in the gap region located between the phosphoribosyl-ATP pyrophosphohydrolase and histidinol dehydrogenase sub-domains. Based on nucleotide and deduced amino acid sequences of the his gene, Pat1 was not closely related to either PN-w or the Paa clade. It appears that rates of evolution of the his gene were fast in cereal Phaeosphaeria species. The possible involvement of meiotic recombination in genetic diversity of the his gene in P. nodorum is discussed.

Alternative splicing and genetic diversity of the white collar-1 (wc-1) gene in cereal Phaeosphaeria pathogens

“…Extraction of total RNA mainly followed the protocols described previously (Wang et al 2007). The mycelia were harvested and flash-frozen in liquid nitrogen.…”

“…Total RNA was extracted from mortar/pestle pulverized mycelia using the RNeasy Plant Mini Kit according to the manufacturer's instructions (Qiagen Inc., Valencia, CA) and treated with RNase-Free DNase I enzyme (Roche Diagnostics Corporation, Indianapolis, IN). Lack of residual gDNA in total RNA was evidenced by not being able to amplify the histidinol dehydrogenase (Hdh1) gene fragment using the primer set 15A/12-1 (ATGCCGGCAGGACCCAGTGA/CTATCAAG CTACGCCAAGTCGC) (Wang et al 2007). The firststrand (1x) cDNA was synthesized with random primer p(dN) 6 and the First Strand cDNA Synthesis Kit (Roche Diagnostics Corporation, Indianapolis, IN).…”

“…In the glyceraldehyde-3-phosphate dehydrogenase (gpd), β-glucosidase (bgl1) and wc-1 genes, Pat1 was grouped together with Paa, Pat3 and PN-b as a single clade, while the RNA polymerase II (RPB2) gene of Pat1 was closely related to PN-w ). In the β-tubulin (tubA) and trifunctional histidine biosynthesis (his) genes, Pat1 was phylogenetically separated from all these Phaeosphaeria pathogens Wang et al 2007). Of the studied wc-1 and other gene nucleotides and their deduced polypeptide sequences, the Pat2 appeared to be the most diversified, and evolved separately from all other cereal Phaeosphaeria species.…”

Genetic linkage map of Phaeosphaeria nodorum, the causal agent of stagonospora nodorum blotch disease of wheat

“…From these, two sets of primer pairs were selected for each of nine genes, and one primer set was selected for Hdh2. In addition, the gene sequences encoding MAP kinase (Mak2), trifunctional histidine biosynthesis (his) and β-tubulin (tubA) were analysed in two parental isolates Solomon et al 2006;Wang et al 2007). No nucleotide variation was identified in these three genes.…”

Phylogenetic and population genetic analyses of Phaeosphaeria nodorum and its close relatives indicate cryptic species and an origin in the Fertile Crescent

“…Restriction fragment length polymorphisms (RFLPs) (Ueng and Chen, 1994) and ITS sequences (Ueng et al, 1998) confirmed genetic differences between the two biotypes and led to the proposal to split Pat into three groups, Pat1, Pat2 and Pat3. Since 1998, the species complex was analyzed using six additional single gene phylogenies including mating-type loci (Bennett et al, 2003;Ueng et al, 2003), b-tubulin (tubA) (Malkus et al, 2005), b-glucosidase (bgl1) (Reszka et al, 2005), RNA polymerase II (Arkadiusz et al, 2006) and histidine synthase (his) (Wang et al, 2007). Until now, the phylogenetic relationships among these Phaeosphaeria spp.…”