DNA extraction from individual Phlebotomine sand flies (Diptera: Psychodidae: Phlebotominae) specimens: Which is the method with better results?

Leonel, João Augusto Franco; Vioti, Geovanna; Alves, Maria Júlia Manso; Silva, Diogo Tiago da; Meneghesso, Pedro Armando; Benassi, Júlia Cristina; Spada, Júlio César Pereira; Galvis-Ovallos, Fredy; Soares, Rodrigo Martins; Oliveira, Trícia Maria Ferreira de Sousa

doi:10.1016/j.exppara.2020.107981

Cited by 5 publications

(8 citation statements)

References 42 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The cost of manual protocols was highly advantageous compared to using the commercial kit. Moreover, Leonel et al (2020) carried out research similar to the present study, which evaluated the cost‐effectiveness of different types of commercial kits and some internal protocols, verifying that the kit DNeasy Blood & Tissue Qiagen® presented the highest cost concerning all methods and that manual protocols showed the best cost–benefit ratio, corroborating the findings of the present study.…”

Section: Discussionsupporting

confidence: 89%

See 1 more Smart Citation

Robust comparative performance of genomic DNA extraction methods from non‐engorged phlebotomine sandflies

Senne

Santos

Araújo

et al. 2022

Medical Vet Entomology

View full text Add to dashboard Cite

The present study is a comparative analysis of DNeasy Blood & Tissue Qiagen® kit (Qiagen®, Hilden, Alemanha), salting out, HotShot and phenol–chloroform protocols to extract DNA from sandflies. In addition, a comparative test using sandflies with and without eyes evaluated the potential inhibitory effect in the cPCR. An inhibition test was performed using an exogenous DNA added to the qPCR. The genomic DNA quality of each sample was evaluated by cPCR based on the cytochrome c oxidase subunit I (cox1) gene. The DNA extraction protocols showed the following percentage of amplification: HotShot (91.6% [55/60]), salting out (71.6% [43/60]), phenol–chloroform (95% [57/60]) and kit DNeasy Blood & Tissue Qiagen® (73.3% [44/60]). The phenol–chloroform method achieved a significantly higher frequency of cox1 gene amplification. The pigment present in the phlebotomine's eyes seems to inhibit cPCR reactions since the frequency of amplification of the cox1 gene increased in the sandflies without eyes (p < 0.0001). The HotShot method showed the highest inhibitory potential. These manual extraction techniques can be an inexpensive and effective alternative to study vector–pathogen interactions.

show abstract

Section: Discussionsupporting

confidence: 89%

“…The cost of manual protocols was highly advantageous compared to using the commercial kit. Moreover, Leonel et al (2020)…”

Section: Discussionmentioning

confidence: 99%

Robust comparative performance of genomic DNA extraction methods from non‐engorged phlebotomine sandflies

Senne

Santos

Araújo

et al. 2022

Medical Vet Entomology

View full text Add to dashboard Cite

show abstract

“…(2017). The in‐house protocol consisted on maceration of dissected sand fly into a cellular lyses detergent Digsol Buffer followed by addition of Proteinase K. Proteins denaturation occurred due the addition of ammonium acetate and DNA preciptation, due to addition of absulute alcohol followed by a 70% alcohol, resulting at 50 μl of re‐suspended DNA in a median concentration (Galvis‐Ovallos et al., 2017; Leonel et al., 2020b). The quality of the extraction was verified by amplifying the cacophonic gene IVS6 present in sand flies, with primers 5LIcac 5′‐GTGGCCGAACATAATGTTAG‐3′ and 3LIcac 5′‐CCACGAACAAGTTCAACATC‐3′, described by Lins et al.…”

Section: Methodsmentioning

confidence: 99%

Xenodiagnosis in four domestic cats naturally infected by Leishmania infantum

Vioti

Silva

Galvis-Ovallos

et al. 2021

Transbounding Emerging Dis

Self Cite

View full text Add to dashboard Cite

Leishmaniasis is a neglected tropical disease that continues to pose a serious public health problem. Albeit dogs have long been held as the major reservoirs of Leishmania infantum, the involvement of domestic cats in the zoonotic cycle of visceral leishmaniasis has gained prominence. Here, 240 cats were evaluated by clinical signs and haematological/biochemical changes compatible with leishmaniasis and were diagnosed by serological, molecular, and parasitological techniques. Thus, four cats naturally infected by L. infantum were submitted to xenodiagnosis. A total of 203 females of Lutzomyia longipalpis were subjected to feeding on four cats, with all females completing the blood meal. Parasitological and molecular assays were carried out to evaluate the presence of L. infantum in the sand flies’ midgut. Promastigotes were observed in 10 females (6.5%) that fed on one cat, and L. infantum DNA was detected in 17 (8.4%) females that fed on two cats. Our results strengthen the evidence that naturally infected cats are capable of transmitting L. infantum to sand flies.

show abstract

“…Despite the growing number of reported examples of magnetic nanomaterials as nucleic acid nano sorbents, relatively little attention is paid to the critical evaluation of adsorption mechanisms and their impact on the nucleic acids’ extraction capacity. The comparative studies so far focus on quantitative analysis of solid- and liquid-phase extraction [ 34 , 35 ] and the confrontation of manual and automatic approaches [ 36 ]. The variety of conditions and magnetic properties of the Fe 3 O 4 cores make a comprehensive comparison of the effects of surface coating difficult.…”

Section: Introductionmentioning

confidence: 99%

Comparative Evaluation of Different Surface Coatings of Fe3O4-Based Magnetic Nano Sorbent for Applications in the Nucleic Acids Extraction

Szymczyk

Drozd

Kamińska

et al. 2022

IJMS

View full text Add to dashboard Cite

Nucleic acid extraction and purification are crucial steps in sample preparation for multiple diagnostic procedures. Routine methodologies of DNA isolation require benchtop equipment (e.g., centrifuges) and labor-intensive steps. Magnetic nanoparticles (MNPs) as solid-phase sorbents could simplify this procedure. A wide range of surface coatings employs various molecular interactions between dsDNA and magnetic nano-sorbents. However, a reliable, comparative evaluation of their performance is complex. In this work, selected Fe3O4 modifications, i.e., polyethyleneimine, gold, silica, and graphene derivatives, were comprehensively evaluated for applications in dsDNA extraction. A family of single batch nanoparticles was compared in terms of morphology (STEM), composition (ICP-MS/MS and elemental analysis), surface coating (UV-Vis, TGA, FTIR), and MNP charge (ζ-potential). ICP-MS/MS was also used to unify MNPs concentration allowing a reliable assessment of individual coatings on DNA extraction. Moreover, studies on adsorption medium (monovalent vs. divalent ions) and extraction buffer composition were carried out. As a result, essential relationships between nanoparticle coatings and DNA adsorption efficiencies have been noticed. Fe3O4@PEI MNPs turned out to be the most efficient nano sorbents. The optimized composition of the extraction buffer (medium containing 0.1 mM EDTA) helped avoid problems with Fe3+ stripping, which improved the validity of the spectroscopic determination of DNA recovery.

show abstract

DNA extraction from individual Phlebotomine sand flies (Diptera: Psychodidae: Phlebotominae) specimens: Which is the method with better results?

Cited by 5 publications

References 42 publications

Robust comparative performance of genomic DNA extraction methods from non‐engorged phlebotomine sandflies

Robust comparative performance of genomic DNA extraction methods from non‐engorged phlebotomine sandflies

Xenodiagnosis in four domestic cats naturally infected by Leishmania infantum

Comparative Evaluation of Different Surface Coatings of Fe3O4-Based Magnetic Nano Sorbent for Applications in the Nucleic Acids Extraction

Contact Info

Product

Resources

About