DNA sequence of satellite bacteriophage P4

Prophage P4 immunity is elicited by a short, 69-nucleotide RNA (CI RNA) coded for within the untranslated leader region of the same operon it controls. CI RNA causes termination of transcription that starts at the promoter P LE and prevents the expression of the distal part of the operon that codes for P4 replication functions (␣ operon). In this work, we identify two sequences in the untranslated leader region of the ␣ operon, seqA and seqC, that are the targets of the P4 immunity factor. seqA and seqC exhibit complementarity to a sequence internal to the CI RNA (seqB). Mutations in either seqA or seqC that alter its complementarity to seqB abolished or reduced P4 lysogenization proficiency and delayed the shutoff of the long transcripts originating from P LE that cover the entire operon. Both seqA and seqC single mutants were still sensitive to P4 prophage immunity, whereas P4 seqA seqC double mutants showed a virulent phenotype. Thus, both functional sites are necessary to establish immunity upon infection, whereas a single site appears to be sufficient to prevent lytic gene expression when immunity is established. A mutation in seqB that restored complementarity to both seqA and seqC mutations also restored premature termination of P LE transcripts, thus suggesting an important role for RNA-RNA interactions between seqB and seqA or seqC in P4 immunity.In most known temperate bacteriophages, prophage immunity is determined by a repressor protein which prevents transcription initiation at promoters controlling the expression of replication functions and of other genes involved in the lytic cycle. Satellite bacteriophage P4 deviates from this model in two respects. (i) Prophage immunity does not prevent transcription initiation of the operon encoding the replication functions (␣ operon); rather, it promotes premature termination of transcription that initiates at P LE , the constitutive promoter of the ␣ operon (9, 10, 12). (ii) The immunity factor is not a protein but a small, 69-nucleotide (nt) RNA (CI RNA) exhibiting complementarity with the nontranslated leader region of the transcripts it regulates (10, 11a, 12).P4 depends on all the morphogenetic genes of a helper phage such as P2 to assemble the viral particle. Autonomous P4 replication requires the expression of a primase-helicase coded for by the P4 ␣ gene (14, 35) and leads either to the lytic cycle (when a helper phage genome is present in the host cell) or to a multicopy plasmid state (in the absence of the helper).As an episome, P4 may also integrate in the host chromosome and establish the lysogenic condition (for a review, see reference 21).Central to the choice and the maintenance of the lysogenic versus the lytic or plasmid condition is the regulation of P4 replication genes (Fig. 1). Soon after infection of a sensitive host, transcription of the ␣ operon starts at the constitutive promoter P LE . Transcription from P LE seems to be intrinsically termination prone, and transcripts of different lengths (0.3 to 0.5, 1.3, and 4.1 kb) are produced....

show abstract

“…1. The P4 genome coordinates are from the updated P4 DNA sequence (GenBank accession number X51522) (15,36).…”

Section: Methodsmentioning

confidence: 99%

Control of transcription termination by an RNA factor in bacteriophage P4 immunity: identification of the target sites

et al. 1995

View full text Add to dashboard Cite

show abstract

“…For am105, an A3T transversion at P4 coordinate 6639 led to the amber codon TAG (triplet 111), whereas for am51, am1, and am52, a C3T transition was detected at P4 positions 6357, 6210, and 5121 (codons 205, 254, and 617, respectively [22]; EMBL accession no. X51522).…”

Section: Resultsmentioning

confidence: 99%

“…Linear P4 DNA was obtained by phenol extraction of phages purified by centrifugation in CsCl (25). For site-directed mutagenesis of the ␣ gene, the procedure of Sayers et al (51) was applied, with the following synthetic oligodeoxynucleotides (deviations from the wild-type ␣ gene [22] are underlined): C35G, CAGACCGGGCCGGGCTGATG; C57G, CACTGATTGCCGTACCAGG; G506E, CATGATACTTTTTTCGCTGCCG CC; K507Q, GCCATGATACTTTGGCCGCTGCC; K507T, GCCATGATAC TAGTGCCGCTGCC; K507A, GCCATGATACTTGCGCCGCTGCC; and K507D, GCCATGATACTGTCGCCGCTGCC. The introduced base changes were verified by sequencing by the chain termination method (48).…”

Section: Methodsmentioning

confidence: 99%

Domain structure of phage P4 alpha protein deduced by mutational analysis

et al. 1995

View full text Add to dashboard Cite

Bacteriophage P4 DNA replication depends on the product of the ␣ gene, which has origin recognition ability, DNA helicase activity, and DNA primase activity. One temperature-sensitive and four amber mutations that eliminate DNA replication in vivo were sequenced and located in the ␣ gene. Sequence analysis of the entire gene predicted a domain structure for the ␣ polypeptide chain (777 amino acid residues, M r 84,900), with the N terminus providing the catalytic activity for the primase and the middle part providing that for the helicase/nucleoside triphosphatase. This model was confirmed experimentally in vivo and in vitro. In addition, the ori DNA recognition ability was found to be associated with the C-terminal third of the ␣ polypeptide chain. The type A nucleotide-binding site is required for P4 replication in vivo, as shown for ␣ mutations at G-506 and K-507. In the absence of an active DnaG protein, the primase function is also essential for P4 replication. Primase-null and helicase-null mutants retain the two remaining activities functionally in vitro and in vivo. The latter was demonstrated by trans complementation studies, indicating the assembly of active P4 replisomes by a primase-null and a helicase-null mutant.Bacteriophage P4 is a temperate satellite phage of Escherichia coli that relies on morphogenetic and lysis functions of the helper phage P2 for its propagation (30). The P4 prophage state is maintained either by integration into the host chromosome or by autonomous replication as a multicopy plasmid. Lysogenization of the host, DNA replication during the lytic cycle, and establishment of the plasmid state all occur independently of helper phage (30). Replication of P4 DNA requires only the P4 ␣ gene product (gp␣) and two cis-acting elements, namely, the origin of replication ori and the sequence-related region crr (cis replication region) (7,26,30,63). Another P4 gene, cnr (copy number regulation), maps directly upstream of ␣; its product has been suggested to control P4 DNA replication, in particular at the plasmid level, maybe by direct interaction of Cnr with gp␣ (59). Thus, protein-protein interaction might modulate at least one specific function of the ␣ protein.The ␣ protein is a multifunctional phage replication protein that recognizes ori and crr by binding to octamer sequences (type I repeats, TGTTCACC [16]) (64). In addition, gp␣ catalyzes the unwinding of DNA via its helicase activity. DNA is unwound with a 3Ј to 5Ј polarity with respect to the strand that gp␣ has bound. The helicase action is fueled by nucleoside triphosphate (NTP) hydrolysis of an interrelated singlestranded DNA-dependent NTPase. gp␣ also functions as a primase, with a template-dependent oligonucleotide-synthesizing activity (56, 64). The primase activity of gp␣ can be replaced by the primase of the host, the DnaG protein (56). However, the P4 burst sizes in the presence of a primase-null ␣ protein and an active DnaG protein were always small, indicating that DnaG can only partially substitute for the primase fu...

show abstract

“…Intriguingly, 8 of the 11 msDNA-positive strains (ECOR24, -38, -39, -40, -41, -70, -71, and -72) from the ECOR collection contain retron-Ec107, suggesting that the retron, including the RT gene, was recently acquired independently by different lineages of E. coli (6). Besides retron-Ec107, retron-Ec67 has been identified in strain ECOR35 (1). Therefore, two more retrons (from strains ECOR23 and -58) from the ECOR collection remained to be identified.…”

mentioning

confidence: 99%

msDNA-Ec48, the smallest multicopy single-stranded DNA from Escherichia coli

Mao

Inouye

1997

J Bacteriol

View full text Add to dashboard Cite

Previously we have reported a novel bacterial reverse transcriptase (RT) from Escherichia coli ECOR58 strains in which the YXDD box was replaced with LVDD (J.-R. Mao, S. Inouye, and M. Inouye, Biochem. Biophys. Res. Commun. 227:489-493, 1996). Here we determined the structure of the multicopy single-stranded DNA (msDNA) produced by the RT. The msDNA was found to consist of a single-stranded DNA of 48 nucleotides in length, the shortest msDNA thus far identified from natural sources. The msDNA, the RT, and the retron are designated msDNA-Ec48, RT-Ec48, and retron-Ec48, respectively. On the basis of the structure of the msr gene, the RNA molecule of msDNA-Ec48 is predicted to be composed of 119 ribonucleotides; it is the longest RNA among the known msDNAs. Analysis of the DNA sequences flanking the retron indicates that retron-Ec48 is associated with a prophage related to phages P2 and P4.Multicopy single-stranded DNA (msDNA) is a satellite DNA in which a short single-stranded DNA is branched out from an internal G residue in a single-stranded RNA via 2Ј,5Ј-phosphodiester linkage (see references 4 and 5 for reviews). msDNA production has been observed in a number of gramnegative bacteria, such as myxobacteria, Rhizobium, Escherichia coli, Salmonella, Klebsiella, and Proteus (11). Interestingly, characterization of several msDNAs from different origins has revealed that all msDNAs so far identified share the following features: (i) the 5Ј end of the single-stranded DNA molecule links to the 2Ј-OH group of an internal G residue of the single-stranded RNA molecule, (ii) both DNA and RNA molecules contain stable secondary structures, and (iii) the 3Ј ends of both RNA and DNA molecules are complementary to each other, forming a heteroduplex.The genetic element responsible for the synthesis of msDNA is a retroelement termed "retron" which is an operon consisting of three genes: msr, msd, and the gene for a reverse transcriptase (RT). To synthesize msDNA, the RNA transcript encompassing msr, msd, and the RT gene is first synthesized from a promoter situated upstream from msr. Subsequently, the 5Ј-end region of the RNA transcript (the part of msr called the a2 sequence) and the 3Ј-end region of the transcript (the immediately upstream region of msd called the a1 sequence) hybridize to each other to form a stable stem structure (see Fig. 3A; also see references 4 and 5 for reviews). As the result, the branching G residue is placed at the end of the a1-a2 stem. RT encoded by the RNA transcript initiates cDNA synthesis from the 2Ј-OH group of the G residue in the middle of the RNA transcript. cDNA synthesis continues on the same RNA as a template and terminates at a specific site, leaving a part of RNA which corresponds to the msr region of the retron (msdRNA) without reverse transcription. The template RNA is removed by RNase H, leaving a few-base overlapping region at the 3Ј ends of DNA and RNA molecules. RT plays an essential role in the biosynthesis of msDNA. It has been shown that in contrast to Myxococcus xanthus, in ...

show abstract

DNA sequence of satellite bacteriophage P4

Abstract: EMBL accession no. X51522 P4 is a satellite bacteriophage of Escherichia coli that requires the products of the late genes of phages of the P2 family for lytic multiplication (1). We present here the complete DNA sequence of P4.

Cited by 62 publications

References 0 publications

Control of transcription termination by an RNA factor in bacteriophage P4 immunity: identification of the target sites

Control of transcription termination by an RNA factor in bacteriophage P4 immunity: identification of the target sites

Domain structure of phage P4 alpha protein deduced by mutational analysis

msDNA-Ec48, the smallest multicopy single-stranded DNA from Escherichia coli

Contact Info

Product

Resources

About