DNA sequencing and analysis of a 67·4 kb region from the right arm of Schizosaccharomyces pombe chromosome II reveals 28 open reading frames including the genes his5, pol5, ppa2, rip1, rpb8 and skb1

Abstract

67 393 bp of contiguous DNA located between markers cdc18 and cdc14 on the right arm of fission yeast chromosome II has been sequenced as part of the European Union Schizosaccharomyces pombe genome sequencing project. The complete sequence, contained in cosmid clones c15C4 and c21H7, has been determined on both strands. Sequence analysis shows that it contains 28 open reading frames capable of coding for proteins, 16 split by one or more introns, but no tRNA, rRNA or transposon sequences. The gene density is one per 2. 4 kb. Six genes have been previously described (his5, pol5, ppa2, rip1, rpb8 and skb1) and 22 are novel. Of the novel genes, 14 have significant similarity with proteins of known function, three have similarities with proteins of unknown function and five show no extensive similarities with known proteins. Sequence similarities suggest that three of the novel genes encode ATP-dependent RNA helicases, two encode transcription factor components and others encode a G-protein, a dehydrogenase, a Rab escort protein, an Abc1-like protein, a lipase, an ATP-binding transport protein, an amino acid permease, an acid phosphatase and a mannosyltransferase.

Analysis of 114 kb of DNA sequence from fission yeast chromosome 2 immediately centromere-distal tohis5

“…ORFs SPBC16H5.07c-14c are not listed as they have been previously reported(Xiang et al, 1999). 2 Numbers given are SWISSPROT/TrEMBL database Accession Nos.…”

Current literature in diabetes

“…Homology searches were performed against EMBL, EMBLNEW and a non‐redundant protein database (SWISSPROT+TREMBL+TREMBLNEW), as described in Xiang et al . (1999). Sequences of predicted proteins were also compared against the non‐redundant protein sequence database using FASTA3 (Pearson and Lipman, 1988) and scanned for Pfam motifs (Sonnhammer et al ., 1998).…”

Subtelomeric sequence from the right arm ofSchizosaccharomyces pombe chromosome I contains seven permease genes

“…Sonication and shotgun cloning were performed as described by Xiang et al . (1999) of each of the three cosmids c869, c922 and c1039, and of long PCR fragments generated from c922 and c1039 using respective primer pairs (CGCACATGGAAGGCCTATATTGGT and CCTATGGGTATTTGGGGATCTTGCA) and (CCGCAATTAACCCTCACTAAAGGG and GCTCGATATGCCATAATGCACGTTC). For sequencing reactions, BigDye dye‐terminator kits (PE Applied Biosystems) diluted 50:50 with halfTERM (Genpak Ltd) were used.…”