DNA Sequencing by the Dideoxy Method

Abstract

In the basic dideoxy sequencing reaction, an oligonucleotide primer is annealed to a single-stranded DNA template and extended by DNA polymerase in the presence of four deoxyribonucleoside triphosphates (dNTPs), one of which is 35S-labeled. The reaction also contains one of four dideoxyribonucleoside triphosphates (ddNTPs), which terminate elongation when incorporated into the growing DNA chain. After completion of the sequencing reactions, the products are subjected to electrophoresis on a high-resolution denaturing polyacrylamide gel and then autoradiographed to visualize the DNA sequence. Three variations of the dideoxy sequencing procedure are currently in use and are presented in this unit. In the "labeling/termination" procedure, primer chains are initially extended and labeled in the absence of terminating ddNTPs, whereas in the traditional "Sanger" procedure, labeling and termination of primer chains occur in a single step. A recent variation of the dideoxy sequencing method is thermal cycle sequencing in which the reaction mixture, containing template DNA, primer, thermostable DNA polymerase, dNTPs, and ddNTPs, is subjected to repeated rounds of denaturation, annealing, and elongation steps. The resulting linear amplification of the sequencing products allows much less template DNA to be used and eliminates independent primer annealing and template denaturation steps, which are required for the labeling/termination or Sanger procedures. The use of automated fluorescent sequencers for four-color dideoxy DNA sequencing is also described in detail.

Insights into the regulation of small RNA expression: SarA represses the expression of two sRNAs inStaphylococcus aureus

“…DNA probes used in the footprinting assays were sequenced according to the standard protocol (41). Specific primers were end-labeled with [γ- 32 P] ATP using T4 polynucleotide kinase (New England Biolabs).…”

Autophosphorylation of the Insulin-like Growth Factor I Receptor Cytoplasmic Domain

“…A BamHI site was included in the 5Ј primer (5ЈGGCCGGGGATCCGAGGCTGGGGAATGGAGT3Ј) and a PstI site was included in the 3Ј primer (5ЈGGCCGGCTGCAGTCAGCAG-GTCGAAGACTG3Ј). The PCR product was inserted into pGEM3Zf(ϩ) vector using the BamHI and PstI sites in the cloning cassette and the sequence of the receptor insert was confirmed by manual dideoxy sequencing (13). This receptor construct was inserted into the pBlueBacHisB transfer vector using the BamHI and PstI sites in the cloning cassette.…”

Bacterial whole genome sequencing: The future of clinical bacteriology

“…The basic steps of dye-terminator Sanger sequencing are outlined below. [9] Dideoxynucleotides are similar to normal nucleotides, except that they contain a hydrogen group on the 3' carbon, instead of a hydroxyl group. When integrated into a sequence, dideoxynucleotides prevent the addition of further nucleotides; because a phosphodiester bond cannot form between the dideoxynucleotide and the next incoming nucleotide.…”