DNA typing of methicillin-resistant Staphylococcus aureus: isolates and factors associated with nosocomial acquisition in two Brazilian university hospitals

Abstract

Control and prevention of methicillin-resistant staphylococcus aureus (MRSA) infections should include early identification of patients at higher risk of MRSA acquisition and analysis of isolates by discriminatory bacterial DNA typing methods. One hundred and three MRSA isolates cultured between Sept. 1994 and Sept. 1995 from 62 patients in two teaching hospitals (hospital 1, in Rio de Janeiro; hospital 2, in Minas Gerais) were tested for antimicrobial resistance and genomic DNA was analysed by pulsed-field gel electrophoresis (PFGE). Ten profiles were identified: A, B, C, I and J in hospital 1 and A, B, D, E, F, G and H in hospital 2. PFGE patterns A and B were isolated at both hospitals. The majority (80%) of isolates had similar PFGE patterns (type A). Subtype A1 was isolated at both hospitals, but was more frequent in hospital 2 (54%), while subtype A2 predominated in hospital 1 (63%). MRSA isolates were resistant to the majority of antimicrobial agents tested. However, susceptibility to vancomycin alone was found in 32% of the isolates at hospital 1, whereas 48% of isolates from hospital 2 were susceptible to both vancomycin and mupirocin, and 34% demonstrated susceptibility to vancomycin, mupirocin and chloramphenicol. Thirty-nine percent of all isolates were mupirocin-resistant, with 90% of these belonging to PFGE pattern A. Four main risk factors were associated with MRSA infection or colonisation which may be useful in the early identification of patients at risk: >7 days hospitalisation (%YO), very dependent patients (84%), invasive procedures (79%) and recent antimicrobial therapy (79%). The data demonstrate that PFGE pattern A is disseminated in both hospitals. However, at both hospitals subtypes of pattern A and the other PFGE types were associated with different antibiotic resistance patterns.

Detection and simultaneous confirmation of Methicillin-Resistant Staphylococcus aureus by an automated Real-Time PCR method with strain differentiation by analysis of DNA melting curve characteristics

“…While antimicrobial susceptibility testing is routinely performed by clinical microbiology laboratories on most bacterial isolates to aid in the identification of new or unusual patterns of antibiotic resistance, the results can only raise the suspicion of an outbreak or the presence of a new strain. This is due to the fact that antibiotic susceptibility testing has relatively limited use in epidemiological studies because of phenotypic variation as observed in this study, and because antibiotic resistance is affected by selective pressure in hospitals [10]. Therefore strain typing provides a more robust epidemiological tool for MRSA infection in the population.…”

“…The acquisition of MRSA has many risk factors associated included prolonged hospitalisation, preceding antimicrobial therapy, use of invasive procedures, treatment in an intensive care unit, surgical procedures and close proximity to a patient colonised or infected with MRSA [4,6,10]. Furthermore, heavy dependency, i.e., patients requiring considerable nursing and other support is another risk factor that should be considered [10].…”

“…Effective control measures for reducing the hospital and community reservoirs of MRSA depend primarily on knowing the risk factors of the exposed population for MRSA colonisation [5,10]. The acquisition of MRSA has many risk factors associated included prolonged hospitalisation, preceding antimicrobial therapy, use of invasive procedures, treatment in an intensive care unit, surgical procedures and close proximity to a patient colonised or infected with MRSA [4,6,10].…”

“…Typing plays an important role in understanding the epidemiology of MRSA and evaluating the effectiveness of infection control and antimicrobial prescribing measures [11]. Several investigators have demonstrated the superiority of macrorestriction analysis by pulsed-field gel electrophoresis (PFGE) for strain characterisation, when compared with other techniques [10][11][12]. This method provides highly reproducible restriction profiles that typically show distinct, well-resolved fragments representing the entire bacterial chromosome and is considered to be the method of choice for DNA fingerprinting of MRSA and other bacterial pathogens [11,12].…”

Characterization of Staphylococcus spp. strains in milk from buffaloes with mastitis in Brazil: the need to identify to species level to avoid misidentification

“…The experiments were performed in triplicate and classified according to Stepanovic et al, 2007. The primers used were: mecA MRS1 (5' TAGAAATGACTGAACGTCCG 3') and MRS2 (5' TTGCGATCAATGTTACCGTAG 3') (Santos et al, 1999); icaA Forward (5' CGATGGGCTCAAGGTGG 3') and icaA Reverse (5' TTCTTTTCGTAGCGACTGTC 3') for the gene icaA, and bap2 Forward (5' GAGCCAGATAAACAACAAGAAG 3') and bap2 Reverse (5' CATGCTCAGCAATAATTGGATC 3') (Potter et al, 2009 (5'GAGTTTGATCCTGGCTCAG 3') and 1492r (5'…”