Dose-Dependent Onset of Regenerative Program in Neutron Irradiated Mouse Skin

Abstract

BackgroundTissue response to irradiation is not easily recapitulated by cell culture studies. The objective of this investigation was to characterize, the transcriptional response and the onset of regenerative processes in mouse skin irradiated with different doses of fast neutrons.Methodology/Principal FindingsTo monitor general response to irradiation and individual animal to animal variation, we performed gene and protein expression analysis with both pooled and individual mouse samples. A high-throughput gene expression analysis, by DNA oligonucleotide microarray was done with three months old C57Bl/6 mice irradiated with 0.2 and 1 Gy of mono-energetic 14 MeV neutron compared to sham irradiated controls. The results on 440 irradiation modulated genes, partially validated by quantitative real time RT-PCR, showed a dose-dependent up-regulation of a sub-class of keratin and keratin associated proteins, and members of the S100 family of Ca2+-binding proteins. Immunohistochemistry confirmed mRNA expression data enabled mapping of protein expression. Interestingly, proteins up-regulated in thickening epidermis: keratin 6 and S100A8 showed the most significant up-regulation and the least mouse-to-mouse variation following 0.2 Gy irradiation, in a concerted effort toward skin tissue regeneration. Conversely, mice irradiated at 1 Gy showed most evidence of apoptosis (Caspase-3 and TUNEL staining) and most 8-oxo-G accumulation at 24 h post-irradiation. Moreover, no cell proliferation accompanied 1 Gy exposure as shown by Ki67 immunohistochemistry.Conclusions/SignificanceThe dose-dependent differential gene expression at the tissue level following in vivo exposure to neutron radiation is reminiscent of the onset of re-epithelialization and wound healing and depends on the proportion of cells carrying multiple chromosomal lesions in the entire tissue. Thus, this study presents in vivo evidence of a skin regenerative program exerted independently from DNA repair-associated pathways.

Enterococcus faecalis promotes osteoclastogenesis and semaphorin 4D expression

“…Primer sequences were as follows: cyclooxygenase 2 (COX-2), 5’(TGAGTACCGCAAACGCTTCTC)3’ and 5’(TGGACGAGGTTTTTCCACCAG)3’; 24 c-fos, 5’(ACGTGGAGCTGAAGGCAGAAC)3’ and 5’(AGCCACTGGGCCTAGATGATG)3’; 25 NFATc1, 5’(CAAGTCTCACCACAGGGCTCACTA) 3’ and 5’(TCAGCCGTCCCAATGAACAG)3’; 25 TRAP, 5’(ACACAGTGATGCTGTGTGGCAAC TC)3’ and 5’(CCAGAGGCTTCCACATATATGATGG)3’; 26 cathepsin K, 5’(CTGAAGATGC TTTCCCATATGTGGG)3’ and 5’(GCAGGCGTTGTTCTTATTCCGAGC)3’; 26 GAPDH 5’(ATGTGTCCGTCGTGGATCTGA)3’ and 5’(ATGCCTGCTTCACCACCTTCT)3’. 27 Real-time PCR was carried out using a Real-Time PCR StepOne system (Applied Biosystems, Foster City, CA, USA) and the PCR products were detected with SYBR Green (Life Technologies, Austin, TX, USA). The reaction conditions were 95℃ for 10 min, 95℃ for 15 s for 40 cycles and 60℃ for 1 min.…”

Carbon-Ion Irradiation Suppresses Migration and Invasiveness of Human Pancreatic Carcinoma Cells MIAPaCa-2 via Rac1 and RhoA Degradation

“…Surprisingly, we did not observe any changes in the expression of GEF and GAP mRNA and GDI protein, or subcellular localization of Rac1 and RhoA in irradiated MIAPaCa-2 cells. Radiation reduces intracellular GTP pool via oxidation of GTP to 8-oxo-dGTP, which is further hydrolyzed by MutT homolog 1 and released from the cells (18,19); however, GTP level was unchanged in irradiated MIAPaCa-2 cells (data not shown).…”

Enterococcus faecalis attenuates osteogenesis through activation of p38 and ERK1/2 pathways in MC3T3‐E1 cells

“…) and 5′‐ATGTGTCCGTCGTGGATCTGA‐3′ and 5′‐ATGCCTGCTTCACCACCTTCT‐3′ forward and reverse primers for GAPDH (Fratini et al . ). The relative expression for each gene was normalized to the expression of GAPDH by means of the 2 −ΔΔCт method.…”

“…Gene expression levels of Bcl-2 and caspase-3 were assayed using real-time PCR. Primer sequences were 5 0 -GTCGCTACCGTCGTGACTTC-3 0 and 5 0 -CAGA CATGCACCTACCCAGC-3 0 forward and reverse primers for Bcl-2 (Kato et al 2010), 5 0 -TGGTGATGAAGGGGT CATTTATG-3 0 and 5 0 -TTCGGCTTTCCAGTCAGACTC-3 0 forward and reverse primers for Caspase-3 (Jones et al 2013) and 5 0 -ATGTGTCCGTCGTGGATCTGA-3 0 and 5 0 -ATGCCTGCTTCACCACCTTCT-3 0 forward and reverse primers for GAPDH (Fratini et al 2011). The relative expression for each gene was normalized to the expression of GAPDH by means of the 2 ÀDDCт method.…”