Double membrane platelet-rich fibrin (PRF) – Synovium succeeds in regenerating cartilage defect at the knee: An experimental study on rabbit

S, Ahmad Taufik; Dirja, Bayu Tirta; Utomo, Dwikora Novembri; Usman, Munyati; Sakti, Muhammad Rizky Prima; Saleh, M. Ruksal; Hatta, Mochammad; Budu,

doi:10.1016/j.heliyon.2023.e13139

Cited by 7 publications

(4 citation statements)

References 40 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The supernatant from this process produced nucleotide extraction results and was stored at −80 °C before performing PCR analysis [ 20 , 24 ]. NF-κB mRNA expression was analyzed and determined by quantitative real-time PCR [ [25] , [26] , [27] ]. Detecting the NF-kβ mRNA expression using specific primers forward: CAGCTCTTCTCAAAGGAGCA and reverse: TCCAGGTCATAGAGAGGCTCA.…”

Section: Methodsmentioning

confidence: 99%

A potential mechanism of miana (Coleus scutellariodes) and quercetin via NF-κB in Salmonella typhi infection

Junita,

Hamid,

Budu

et al. 2023

Heliyon

Self Cite

View full text Add to dashboard Cite

Section: Methodsmentioning

confidence: 99%

A potential mechanism of miana (Coleus scutellariodes) and quercetin via NF-κB in Salmonella typhi infection

Junita,

Hamid,

Budu

et al. 2023

Heliyon

Self Cite

View full text Add to dashboard Cite

“…A recent paper conducted by Balta and Kurnaz analyzed histologically and macroscopically the formed cartilage in rabbits after biological adjuvants (PRF) individually and in combination, showing statistical differences in favor of the first group against the control, especially when used in combination (19) . Tafiuk et al showed an effective regeneration of cartilage defects after a surgical treatment integrating microfracture (MFx), synovial grafts, and PRF membranes (20) . Further, Wong et al, after developing a one-stage method that combined PRF and autologous cartilage autografts, reported a relatively complete cartilage repair (21) .…”

Section: Autologous Matrix-induced Chondrogenesis and Arthroscopy-aut...mentioning

confidence: 99%

Surgical treatment for talus Osteochondral Lesions: What's new?

Soares Baumfeld,

Dornela,

Baumfeld

et al. 2024

J Foot Ankle

View full text Add to dashboard Cite

Osteochondral lesions of the talus (OLTs) are a common pathology encountered by foot and ankle surgeons. Symptomatic cartilage lesions in the ankle pose a significant challenge and often require surgical intervention to alleviate pain, improve joint function, and restore the integrity of the articular surface. Possible treatment options, including operative and nonoperative management, havebeen widely discussed in the literature, with substantial heterogeneity regarding treatment approaches and resulting patient-reportedoutcomes and joint function metrics. A general problem regarding OLT is that this entity is not clearly defined, nor its description,location, or best treatment for each type that may be required in some symptomatic presentations. The focus of our paper was to show the proper treatment for each lesion, including location, deepness, vascularity, and capability of healing. Level of evidence V; Expert opinion.

show abstract

“…In an injured cartilage rabbit model, Kuo et al [ 45 ] reported the regenerative potential of cartilage with higher T2 values via MRI in the PRF-treated group compared to the control group, showing a reduction in proteoglycans and a progressive increase in collagen content. In a cartilage defect rabbit model, Taufik et al [ 81 ] developed a treatment method involving the integration of microfractures, synovial grafts, and a PRF membrane. This combined method effectively promoted the regeneration of cartilage defects.…”

Section: Clinical Applicationmentioning

confidence: 99%

Current Progress of Platelet-Rich Derivatives in Cartilage and Joint Repairs

Bai

Tang

et al. 2023

IJMS

View full text Add to dashboard Cite

In recent years, several types of platelet concentrates have been investigated and applied in many fields, particularly in the musculoskeletal system. Platelet-rich fibrin (PRF) is an autologous biomaterial, a second-generation platelet concentrate containing platelets and growth factors in the form of fibrin membranes prepared from the blood of patients without additives. During tissue regeneration, platelet concentrates contain a higher percentage of leukocytes and a flexible fibrin net as a scaffold to improve cell migration in angiogenic, osteogenic, and antibacterial capacities during tissue regeneration. PRF enables the release of molecules over a longer period, which promotes tissue healing and regeneration. The potential of PRF to simulate the physiology and immunology of wound healing is also due to the high concentrations of released growth factors and anti-inflammatory cytokines that stimulate vessel formation, cell proliferation, and differentiation. These products have been used safely in clinical applications because of their autologous origin and minimally invasive nature. We focused on a narrative review of PRF therapy and its effects on musculoskeletal, oral, and maxillofacial surgeries and dermatology. We explored the components leading to the biological activity and the published preclinical and clinical research that supports its application in musculoskeletal therapy. The research generally supports the use of PRF as an adjuvant for various chronic muscle, cartilage, and tendon injuries. Further clinical trials are needed to prove the benefits of utilizing the potential of PRF.

show abstract

Double membrane platelet-rich fibrin (PRF) – Synovium succeeds in regenerating cartilage defect at the knee: An experimental study on rabbit

Cited by 7 publications

References 40 publications

A potential mechanism of miana (Coleus scutellariodes) and quercetin via NF-κB in Salmonella typhi infection

A potential mechanism of miana (Coleus scutellariodes) and quercetin via NF-κB in Salmonella typhi infection

Surgical treatment for talus Osteochondral Lesions: What's new?

Current Progress of Platelet-Rich Derivatives in Cartilage and Joint Repairs

Contact Info

Product

Resources

About