Double-stranded DNA-templated cleavage of oligonucleotides containing a P3′→N5′ linkage triggered by triplex formation: the effects of chemical modifications and remarkable enhancement in reactivity

Abstract

We recently reported double-stranded DNA-templated cleavage of oligonucleotides as a sequence-specific DNA-detecting method. In this method, triplex-forming oligonucleotides (TFOs) modified with 5′-amino-2′,4′-BNA were used as a DNA-detecting probe. This modification introduced a P3′→N5′ linkage (P–N linkage) in the backbone of the TFO, which was quickly cleaved under acidic conditions when it formed a triplex. The prompt fission of the P–N linkage was assumed to be driven by a conformational strain placed on the linkage upon triplex formation. Therefore, chemical modifications around the P–N linkage should change the reactivity by altering the microenvironment. We synthesized 5′-aminomethyl type nucleic acids, and incorporated them into TFOs instead of 5′-amino-2′,4′-BNA to investigate the effect of 5′-elongation. In addition, 2′,4′-BNA/LNA or 2′,5′-linked DNA were introduced at the 3′- and/or 5′-neighboring residues of 5′-amino-2′,4′-BNA to reveal neighboring residual effects. We evaluated the triplex stability and reaction properties of these TFOs, and found out that chemical modifications around the P–N linkage greatly affected their reaction properties. Notably, 2′,5′-linked DNA at the 3′ position flanking 5′-amino-2′,4′-BNA brought significantly higher reactivity, and we succeeded in indicating that a TFO with this modification is promising as a DNA analysis tool.

Cleavage of Oligonucleotides Containing a P3’→N5’ Phosphoramidate Linkage Mediated by Single-Stranded Oligonucleotide Templates

“…Initially, we evaluated the ability of ON-1 – ON-8 to form duplexes with oligonucleotide templates. Although we tried to assess the affinity of ON-1 – ON-8 for template oligonucleotides under the acidic conditions in which the cleavage reactions were performed, it was not possible due to acid lability of ON-1 – ON-8 [ 29 ]. Therefore, we performed the melting experiments using ON-0 , which has no P-N linkage, at pH 4.0 and under milder conditions (pH 6.0).…”

“…We performed hydrolysis experiments with ON-1 – ON-8 and single-stranded oligonucleotide templates ( PSD , ASD and ASR ) under conditions identical to those described previously for double-stranded DNA-templated reactions (pH 4.0, 40 °C), [ 28 , 29 ]. However, based on the duplex-forming ability of the oligonucleotides estimated from the UV melting experiments, the duplexes containing ASR were estimated to be destabilized under acidic conditions.…”

“… a Conditions; 140 mM KCl, 10 mM MgCl 2 , 1.0 mM sodium phosphate, 10 mM sodium citrate-HCl buffer, 3.35 µM each strand, pH 4.0, 40°C; b Taken from the previous reports [ 28 , 29 ]; c PDD (parallel double-stranded DNA); 5’-d(GCTAAAAAGAAAGAGAGATCG)-3’/5’-d(CGATCTCTCTTTCTTTTTAGC)-3’; d Not determined due to low reactivity. …”

“…We presented a new type of DNA-templated reaction-based DNA detection; this method involves probe cleavage that is templated by double-stranded DNA (dsDNA) [ 26 , 27 , 28 , 29 ]. In this method, cleavage reactions are accelerated because of conformational strain induced by triplex formation, not because of the effective molecularity.…”

“…This linkage was more susceptible to acid-mediated hydrolysis upon triplex formation, and the enhanced susceptibility was due to conformational strain on the P-N linkage induced by triplex formation. Previously, we examined the effects of chemical modifications that alter the microenvironment around the P-N linkage and change the extent of the conformational strain; these chemical modifications had substantial effects on the observed pseudo first-order rate constants ( k obs s) of the hydrolysis with the dsDNA templates [ 29 ]. These findings indicated that when the P-N linkage is subjected to sufficient strain, the linkage promptly breaks upon hybridization to the template.…”