Droplet digital PCR for rapid enumeration of viral genomes and particles from cells and animals infected with orthopoxviruses

Americo, Jeffrey L.; Earl, Patricia L.; Moss, Bernard

doi:10.1016/j.virol.2017.08.005

Cited by 26 publications

(23 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Total RNA was extracted at 8 h after infection with RNeasy RNA mini kit (Qiagen), quantitated with the nanodrop spectrophotometer and equal amounts of RNA were treated with DNase prior to reverse-transcription with a SuperScript IV First-Strand synthesis system using oligo-dT primers (ThermoFisher). Equal amounts of DNA or cDNA from each sample were then serially diluted and analyzed with gene-specific primers (E11L for viral genomic DNA) by ddPCR according to the protocol described previously using an automated droplet generator and the QX200 droplet reader (Bio-Rad) [ 46 ]. Primers used for mRNA quantification: I1L (5’ TGGAAAACTGGATGATACAGGCA 3’; 5’ TGTGTAGCGCTTCTTTTTAGTC 3’); A3L (5’ CTATAGACAAAATAGAAGCC 3’; 5’ CCATGATTAGAAAAGCAATTATG 3’).…”

Section: Methodsmentioning

confidence: 99%

Zinc-finger antiviral protein (ZAP) is a restriction factor for replication of modified vaccinia virus Ankara (MVA) in human cells

et al. 2020

Self Cite

View full text Add to dashboard Cite

Modified vaccinia virus Ankara (MVA) is an approved smallpox vaccine and a promising vaccine vector for other pathogens as well as for cancer therapeutics with more than 200 current or completed clinical trials. MVA was derived by passaging the parental Ankara vaccine virus hundreds of times in chick embryo fibroblasts during which it lost the ability to replicate in human and most other mammalian cells. Although this replication deficiency is an important safety feature, the genetic basis of the host restriction is not understood. Here, an unbiased human genome-wide RNAi screen in human A549 cells revealed that the zincfinger antiviral protein (ZAP), previously shown to inhibit certain RNA viruses, is a host restriction factor for MVA, a DNA virus. Additional studies demonstrated enhanced MVA replication in several human cell lines following knockdown of ZAP. Furthermore, CRISPR-Cas9 knockout of ZAP in human A549 cells increased MVA replication and spread by more than one log but had no effect on a non-attenuated strain of vaccinia virus. The intact viral C16 protein, which had been disrupted in MVA, antagonized ZAP by binding and sequestering the protein in cytoplasmic punctate structures. Studies aimed at exploring the mechanism by which ZAP restricts MVA replication in the absence of C16 showed that knockout of ZAP had no discernible effect on viral DNA or individual mRNA or protein species as determined by droplet digital polymerase chain reaction, deep RNA sequencing and mass spectrometry, respectively. Instead, inactivation of ZAP reduced the number of aberrant, dense, spherical particles that typically form in MVA-infected human cells, suggesting that ZAP has a novel role in interfering with a late step in the assembly of infectious MVA virions in the absence of the C16 protein.

show abstract

Section: Methodsmentioning

confidence: 99%

Zinc-finger antiviral protein (ZAP) is a restriction factor for replication of modified vaccinia virus Ankara (MVA) in human cells

et al. 2020

Self Cite

View full text Add to dashboard Cite

show abstract

“…For genome particles quantification, real time polymerase chain reaction (qPCR) is usually the method of choice. Droplet digital polymerase chain reaction (ddPCR) has also been recently used for quantifying viral genome, without the need for a standard curve [154,155]. Depending on the final use of virus-based particles, and different from mAbs, infectivity can be a critical parameter.…”

Section: Analytics In Process Developmentmentioning

confidence: 99%

Current challenges in biotherapeutic particles manufacturing

Moleirinho

Silva

Alves

et al. 2019

Expert Opinion on Biological Therapy

View full text Add to dashboard Cite

Introduction: The development of novel complex biotherapeutics led to new challenges in biopharmaceutical industry. The potential of these particles has been demonstrated by the approval of several products, in the different fields of gene therapy, oncolytic therapy, and tumor vaccines. However, their manufacturing still presents challenges related to the high dosages and purity required. Areas covered: The main challenges that biopharmaceutical industry faces today and the most recent developments in the manufacturing of different biotherapeutic particles are reported here. Several unit operations and downstream trains to purify virus, virus-like particles and extracellular vesicles are described. Innovations on the different purification steps are also highlighted with an eye on the implementation of continuous and integrated processes. Expert opinion: Manufacturing platforms that consist of a low number of unit operations, with higheryielding processes and reduced costs will be highly appreciated by the industry. The pipeline of complex therapeutic particles is expanding and there is a clear need for advanced tools and manufacturing capacity. The use of single-use technologies, as well as continuous integrated operations, are gaining ground in the biopharmaceutical industry and should be supported by more accurate and faster analytical methods.

show abstract

“…In this respect, only faeces obtained with non-invasive procedure is not allowed. Several studies have demonstrated the efficient dPCR platform searching different viruses [20][21][22][23][24][25]. Moreover, rapid, accurate and affordable molecular technology can be predictable with particular emphasis on emerging techniques (next generation sequencing, digital PCR, point of care testing and syndromic diagnosis) to simplify viral diagnosis in the next future [24,25].…”

Section: Resultsmentioning

confidence: 99%

Digital PCR Platform as a Tool to Determine the Canine Coronavirus (CCoV) Genome in Clinical Samples

2018

Arch Vet Sci Tecnol

View full text Add to dashboard Cite

Canine coronavirus (CCoV) is an important pathogen that affect dogs. Here we assessed a digital real-time based PCR (dPCR) for the detection of CCoV from infected AF-72 cells and directly from faeces from 100 symptomatic dogs. The results obtained from dPCR were compared to real-time TaqMan® based PCR assay (qPCR) and positive samples were submitted to phylogenetic analysis. Thus, dPCR had an equal sensitivity, 101 copies/μl of partial M CCoV gene, when compared to qPCR results with a good agreement in all analysis. These results indicated that the dPCR could be an alternative technique for the diagnosis of CCoV from clinical samples with advantage of simplicity and sensitivity.

show abstract

Droplet digital PCR for rapid enumeration of viral genomes and particles from cells and animals infected with orthopoxviruses

Cited by 26 publications

References 21 publications

Zinc-finger antiviral protein (ZAP) is a restriction factor for replication of modified vaccinia virus Ankara (MVA) in human cells

Zinc-finger antiviral protein (ZAP) is a restriction factor for replication of modified vaccinia virus Ankara (MVA) in human cells

Current challenges in biotherapeutic particles manufacturing

Digital PCR Platform as a Tool to Determine the Canine Coronavirus (CCoV) Genome in Clinical Samples

Contact Info

Product

Resources

About