Dystroglycan is involved in the activation of ERK pathway inducing the change of AQP4 expression in scratch-injured astrocytes

Zhang, Gaoli; Ma, Peiying; Wan, Shanshan; Xu, Jin; Yang, Mei; Qiu, Gouping; Zhuo, Fei; Xu, Shan; Huo, Jiechao; Ju, Yuchan; Liu, Hui

doi:10.1016/j.brainres.2019.146347

Cited by 10 publications

(6 citation statements)

References 46 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Dystroglycan forms a complex with dystrophin and anchors AQP4 on the cell membrane. Interestingly, dystroglycan increases AQP4 expression by ERK1/2 activation, which is blocked by U0126 [57]. However, the present study showed that U0126 increased dystrophin-AQP4 expression.…”

Section: Discussioncontrasting

confidence: 52%

The Regional Specific Alterations in BBB Permeability are Relevant to the Differential Responses of 67-kDa LR Expression in Endothelial Cells and Astrocytes Following Status Epilepticus

Park

Kang

2019

IJMS

View full text Add to dashboard Cite

Status epilepticus (a prolonged seizure activity, SE) differently affects vasogenic edema formation and dystrophin-aquaporin 4 (AQP4) expressions between the rat hippocampus and the piriform cortex (PC). In the present study, we explored whether the 67-kDa laminin receptor (LR) expression was relevant to the regional specific susceptibility of vasogenic edema at 3 days after SE. In spite of no difference in expression levels of 67-kDa LR, dystrophin, and AQP4 under physiological conditions, SE-induced serum extravasation was more severe in the PC than the hippocampus. Western blots demonstrated that SE reduced expression levels of 67-kDa LR, dystrophin, and AQP4 in the PC, but not in the hippocampus proper. Immunofluorescent studies revealed that SE increased 67-kDa LR expression in reactive CA1 astrocyte, but reduced it in the PC and the molecular layer of the dentate gyrus due to massive astroglial loss. Furthermore, SE decreased expressions of endothelial 67-kDa LR and SMI-71 (endothelial brain barrier antigen) in these regions. The 67-kDa LR neutralization evoked serum extravasation in these regions of normal animals without astroglial loss. Similar to SE, 67-kDa LR neutralization also reduced dystrophin-AQP4 expressions in the PC more than the total hippocampus. Furthermore, 67-kDa LR IgG infusion increased phosphorylation of extracellular signal-regulated kinase 1/2 (ERK1/2), but not c-Jun N-terminal kinase, independent of phosphoprotein enriched in astrocytes of 15 kDa (PEA15) activity. Co-treatment of U0126 (an ERK1/2 inhibitor) alleviated vasogenic edema formation and the reduced dystrophin-AQP4 expressions induced by 67-kDa LR neutralization. The 67-kDa LR IgG infusion also increased the susceptibility to SE induction. Therefore, our findings suggested that the cellular specific alterations in 67-kDa LR expression might be involved in the severity of SE-induced vasogenic edema formation in regional specific manners, which might affect the susceptibility to SE induction.

show abstract

Section: Discussioncontrasting

confidence: 52%

The Regional Specific Alterations in BBB Permeability are Relevant to the Differential Responses of 67-kDa LR Expression in Endothelial Cells and Astrocytes Following Status Epilepticus

Park

Kang

2019

IJMS

View full text Add to dashboard Cite

show abstract

“…Each well of a 6-well plate contained 0.8 × 10 6 cells, 5 µL siRNA, 3.75 µL Lipofectamine 3000, and 250 μL Opti-MEM (Gibco, Grand Island, NY, USA). Each well of 24-well plates contained 0.6 × 10 5 cells per well, 1.25 μL siRNA, 0.75 μL Lipofectamine 3000, and 50 μL Opti-MEM [ 52 ]. The sequence of TBCB was as follows: forward 5′-GCAUCCAUGUCAUUGACCATT-3′ and reverse 5′-UGGUCAAUGACAUGGAUGCTT-3′.…”

Section: Methodsmentioning

confidence: 99%

“…To confirm whether the ERK1/2 signalling pathway regulated TBCB expression after alcohol exposure, we interfered with it and observed the effects. Astrocytes were randomly divided into three groups: the solvent control group (Con) was cultured in medium containing 2 µL DMSO (Saimike, Chongqing, China) [ 52 ]; the ERK1/2 agonist group (TPA) was cultured in medium containing 200 µM TAP (ERK1/2 agonist, CST [ 52 ]) dissolved in 2 µL DMSO; and the ERK1/2 inhibitor group (U0126) was cultured in medium containing 10 mM U0126 (ERK1/2 inhibitor, Selleck, Shanghai, China [ 52 ]) dissolved in 2 µL DMSO. After 1 h, the medium containing the treatments was removed and complete fresh medium was added.…”

Section: Methodsmentioning

confidence: 99%

“…The PCR conditions were denaturation at 94 • C for 3 min, followed by 34 cycles of denaturation at 94 • C for 30 s, annealing at 55 • C for 30 s, and extension at 72 • C for 30 s. All qPCRs were run on a CFX96 real-time system (Bio-Rad). The 2 −∆∆Ct method was used to calculate the RNA or miRNA level fold change compared to the control samples [52]. The primer sequences (5 -> 3 ) were as follows: TBCB, forward ATGGAGCAGACGACAAGTTCT, reverse CCGTCATCCACAGGATAG-GAG, product size (77 bp); β-actin (control), forward CAGCCTTCCTTCTTGGGTA, reverse TTTACGGATGTCAACGTCACAC, product size (87 bp).…”

Section: Reverse Transcription Real-time Pcrmentioning

confidence: 99%

See 1 more Smart Citation

ERK1/2 Signalling Pathway Regulates Tubulin-Binding Cofactor B Expression and Affects Astrocyte Process Formation after Acute Foetal Alcohol Exposure

et al. 2022

Self Cite

View full text Add to dashboard Cite

Foetal alcohol spectrum disorders (FASDs) are a spectrum of neurological disorders whose neurological symptoms, besides the neuronal damage caused by alcohol, may also be associated with neuroglial damage. Tubulin-binding cofactor B (TBCB) may be involved in the pathogenesis of FASD. To understand the mechanism and provide new insights into the pathogenesis of FASD, acute foetal alcohol exposure model on astrocytes was established and the interference experiments were carried out. First, after alcohol exposure, the nascent astrocyte processes were reduced or lost, accompanied by the absence of TBCB expression and the disruption of microtubules (MTs) in processes. Subsequently, TBCB was silenced with siRNA. It was severely reduced or lost in nascent astrocyte processes, with a dramatic reduction in astrocyte processes, indicating that TBCB plays a vital role in astrocyte process formation. Finally, the regulating mechanism was studied and it was found that the extracellular signal-regulated protease 1/2 (ERK1/2) signalling pathway was one of the main pathways regulating TBCB expression in astrocytes after alcohol injury. In summary, after acute foetal alcohol exposure, the decreased TBCB in nascent astrocyte processes, regulated by the ERK1/2 signalling pathway, was the main factor leading to the disorder of astrocyte process formation, which could contribute to the neurological symptoms of FASD.

show abstract

“…To confirm whether the ERK1/2 signaling pathway regulated the expression of TBCB after alcohol exposure, the ERK1/2 interference experiment was carried out. Astrocytes were randomly divided into three groups: the solvent control group (Con), cultured in a medium containing 2 μl dissolved in dimethyl sulfoxide (DMSO, Saimike; Zhang et al, 2019 ); ERK1/2 agonist group (TPA), cultured in a medium containing 200 μM TAP (ERK1/2 agonist, CST; Zhang et al, 2019 ) dissolved in 2 μl DMSO; ERK1/2 inhibitor group (U0126), cultured in medium containing 10 mM U0126 (MEK1/2 inhibitor, Selleck; Zhang et al, 2019 ) dissolved in 2 μl DMSO. After 1 h, the drugged medium was removed, and DMEM/F12 supplemented with 10% FBS was added.…”

Section: Methodsmentioning

confidence: 99%

Decreased tubulin-binding cofactor B was involved in the formation disorder of nascent astrocyte processes by regulating microtubule plus-end growth through binding with end-binding proteins 1 and 3 after chronic alcohol exposure

Zheng

Yang²,

Chen³

et al. 2022

Front. Cell. Neurosci.

Self Cite

View full text Add to dashboard Cite

Fetal alcohol syndrome (FAS) is a neurological disease caused by excessive drinking during pregnancy and characterized by congenital abnormalities in the structure and function of the fetal brain. This study was proposed to provide new insights into the pathogenesis of FAS by revealing the possible mechanisms of alcohol-induced astrocyte injury. First, a chronic alcohol exposure model of astrocytes was established, and the formation disorder was found in astrocyte processes where tubulin-binding cofactor B (TBCB) was decreased or lost, accompanied by disorganized microtubules (MT). Second, to understand the relationship between TBCB reduction and the formation disorder of astrocyte processes, TBCB was silenced or overexpressed. It caused astrocyte processes to retract or lose after silencing, while the processes increased with expending basal part and obtuse tips after overexpressing. It confirmed that TBCB was one of the critical factors for the formation of astrocyte processes through regulating MT plus-end and provided a new view on the pathogenesis of FAS. Third, to explore the mechanism of TBCB regulating MT plus-ends, we first proved end-binding proteins 1 and 3 (EB1/3) were bound at MT plus-ends in astrocytes. Then, through interference experiments, we found that both EB1 and EB3, which formed in heterodimers, were necessary to mediate TBCB binding to MT plus-ends and thus regulated the formation of astrocyte processes. Finally, the regulatory mechanism was studied and the ERK1/2 signaling pathway was found as one of the main pathways regulating the expression of TBCB in astrocytes after alcohol injury.

show abstract

Dystroglycan is involved in the activation of ERK pathway inducing the change of AQP4 expression in scratch-injured astrocytes

Cited by 10 publications

References 46 publications

The Regional Specific Alterations in BBB Permeability are Relevant to the Differential Responses of 67-kDa LR Expression in Endothelial Cells and Astrocytes Following Status Epilepticus

The Regional Specific Alterations in BBB Permeability are Relevant to the Differential Responses of 67-kDa LR Expression in Endothelial Cells and Astrocytes Following Status Epilepticus

ERK1/2 Signalling Pathway Regulates Tubulin-Binding Cofactor B Expression and Affects Astrocyte Process Formation after Acute Foetal Alcohol Exposure

Decreased tubulin-binding cofactor B was involved in the formation disorder of nascent astrocyte processes by regulating microtubule plus-end growth through binding with end-binding proteins 1 and 3 after chronic alcohol exposure

Contact Info

Product

Resources

About