Effect of Carbohydrate Composition in Barley and Oat Cultivars on Microbial Ecophysiology and Proliferation of Salmonella enterica in an In Vitro Model of the Porcine Gastrointestinal Tract

Abstract

The influence of the carbohydrate (CHO) composition of cereal cultivars on microbial ecophysiology was studied using an in vitro model of the porcine gastrointestinal tract. Ten hull-less barley cultivars, six barley cultivars with hulls, six oat cultivars, and six oat groats that differed in ␤-glucan, nonstarch polysaccharide (NSP), and starch contents and starch type were hydrolyzed enzymatically and incubated for 72 h with pig feces. Fermentation kinetics were modeled, and microbial compositions and short-chain fatty acid (SCFA) profiles were analyzed using terminal restriction fragment length polymorphism and gas chromatography. Cluster analysis and canonical ordination revealed different effects on fermentation and microbial ecology depending on the type of CHO and cultivar. First, in cultivars of barley with hulls and oats, the cellulose and insoluble NSP contents (i) increased Ruminococcus flavefaciens-like and Clostridium xylanolyticum-like phylotypes, (ii) increased acetate production, and (iii) decreased fermentation activity. Second, in hull-less barley cultivars the ␤-glucan, amylose, amylopectin, crude protein, and soluble NSP contents determined the microbial community composition and activity as follows: (i) the amylose contents of the hull-less barley varieties increased the butyrate production and the abundance of Clostridium butyricum-like phylotypes, (ii) the ␤-glucan content determined the total amounts of SCFA, and (iii) the amylopectin and starch contents affected the abundance of Clostridium ramosum-like phylotypes, members of Clostridium cluster XIVa, and Bacteroides-like bacteria. Finally, the effect of CHO on proliferation of Salmonella enterica in the model was determined. Salmonella cell counts were not affected, but the relative proportion of Salmonella decreased with hull-less barley cultivars and increased with oat cultivars as revealed by quantitative PCR. Our results shed light on the complex interactions of cereal CHO with intestinal bacterial ecophysiology and the possible impact on host health.

Higher-Level Production of Volatile Fatty Acids In Vitro by Chicken Gut Microbiotas than by Human Gut Microbiotas as Determined by Functional Analyses

“…To compare the fermentation metabolites of microbiotas derived from chicken cecum samples and human colon samples, batch culture fermentations were first conducted according to procedures described previously by Pieper et al (34). Briefly, 100-ml serum bottles with rubber stoppers were filled with 40 ml of VL or VI medium.…”

Nonstarch Polysaccharides Modulate Bacterial Microbiota, Pathways for Butyrate Production, and Abundance of Pathogenic Escherichia coli in the Pig Gastrointestinal Tract

“…Total genomic DNA was extracted from ileal effluent and feces using a FastDNA kit (Qiagen, Mississauga, Ontario, Canada) according to the manufacturer's instructions. Partial fragments of bacterial 16S rRNA genes were amplified by PCR using universal forward primer S-D-Bact-0008-a-S-20 (AGAGTTTGATCMTGGCTCAG), labeled with 6-carboxyflourescein (FAM), and reverse primer S-D-Bact-0926-a-S-20 (CCGTCAATTCATTTGAGTTT) (37). The purified PCR product (200 ng) was digested at 37°C overnight using 15 U of MspI (Fermentas, Burlington, CA) in 2 l reaction buffer and UV-sterilized Millipore water, made up to 20 l. Two microliters of the digestion solution was subsequently mixed with 9 l of formamide and 0.5 l of an internal size standard (ABI GeneScan 600 LIZ size standard) and denatured at 95°C for 5 min, followed by cooling on ice for 2 min.…”

“…Purified NSP fractions are increasingly available from the bioprocessing industry for use in food preparation and potentially in animal feeds, where economics and possible health benefits warrant this use. However, less is known about the fermentative properties of purified NSP fractions than about those of NSP in the grain matrix (37), which may also differ according to their origins.…”

“…Most studies pertaining on the effect of diet composition on the bacterial community in pigs have employed natural NSP sources and cereal-based diets, thereby resulting in a mixture of different soluble and insoluble NSP showing considerable interactions and modification of intestinal bacterial ecophysiology (6,36,37). Purified NSP fractions are increasingly available from the bioprocessing industry for use in food preparation and potentially in animal feeds, where economics and possible health benefits warrant this use.…”

Effects of Diet on Gut Microbiota Profile and the Implications for Health and Disease

“…The cereal amylose content increased the abundance of Clostridium butyricum -like phylotypes, whereas the amylopectin and starch contents increased the abundance of Clostridium ramosum -like phylotypes, members of Clostridium cluster XIVa and Bacteroides -like bacteria [90,91,92,93]. …”