Effect of chronic glutamate administration to pregnant rats during gestation on metabotropic glutamate receptors from mothers and full-term fetuses brain

Abstract

Chronic glutamate treatment during gestational period caused a significant decrease in total metabotropic glutamate receptors (mGluR) number. Similar results were observed on the steady-state level of mGlu(1) receptor detected by immunoblotting assays, suggesting that this is the main receptor subtype modulated by agonist exposure. Furthermore, no variations on mRNA coding mGlu(1) receptor were found, suggesting post-transcriptional modulation as a possible mechanism of the lost of receptor detected at the membrane surface. On the other hand, western-blotting to determine level of G(q/11) protein and phospholipase C beta(1) revealed a significant decrease of both proteins in mothers brain. This decrease was associated with significant variation in glutamate and DHPG-stimulated phospholipase C activity. No significant differences on mGluR transduction pathway components were observed in fetuses brain. These results suggest that glutamate intake during pregnancy causes a down-regulation of different proteins involved in glutamate response mediated by mGluR only in mothers brain without significantly affecting fetuses brain.

Effect of chronic gestational treatment with the adenosine A1 receptor agonist R‐phenylisopropyladenosine on metabotropic glutamate receptors/phospholipase C pathway in maternal and fetal brain

“…The down‐regulation of mGlu reported in this work in maternal brain could be, therefore, a response to receptor overstimulation evoked by excessive glutamate release. This is in agreement with previous studies showing the down‐regulation of mGlu 1 or mGlu 5 receptors caused by a prolonged treatment with mGlu receptor agonists in C6 glioma cells (Albasanz et al, 2002) and astrocytes (Balazs et al, 1997) and in vivo when glutamate is chronically consumed during gestation (León Navarro et al, 2005). The results obtained by Western blot suggest that both mGlu 1 and mGlu 5 receptors are down‐regulated in response to chronic R‐PIA treatment in maternal brain, which agrees with the decrease of specific binding of [ 3 H]quisqualic acid in plasma membranes from gestant rats treated with R‐PIA.…”

“…Total RNA was isolated by guanidium thiocyanate/phenol/chloroform extraction following the method of Chomczynski and Sacchi (1987). RT‐PCR assays were performed as described by León Navarro and coworkers (2005) using the primers 5′‐AAATCTACAGCAATGCTGGCGA‐3′ and 5′‐CTTCGATGACTTCATCTCTGT‐3′ for mGlu 1 receptor, 5′‐TGAAAGAAGATGTACGAGGGAGTG‐3′ and 5′‐TTT CTTGGAGCGGAAGGAAGAAG‐3′ for mGlu 5 receptor, 5′‐GAGAACCGAATGGAGGAGAGCAA‐3′ and 5′‐GTCCAC GAACATCTTCAGGATGAA‐3′ for αG q/11 , and 5′‐TTT TCGGCAGACCGGAAGCGA‐3′ and 5′‐TGCTGTTGG GCTCGTACTTCT‐3′ for PLCβ 1 . PCR products were analyzed by electrophoresis in 2% agarose gels and stained with ethidium bromide.…”

Effect of glutamate intake during gestation on adenosine A1 receptor/adenylyl cyclase pathway in both maternal and fetal rat brain

“…2002). However, as recently described, we did not detect significant variation in either food intake or weight gain of animals (León Navarro et al. 2005).…”

“…In the present work, we have shown that chronic glutamate intake during pregnancy induces a down‐regulation of αGi 3 . A possible explanation may be drawn from a previous work in which the effect of chronic glutamate administration during gestation on metabotropic glutamate receptors from maternal and full‐term fetal brains was studied (León Navarro et al. 2005).…”

“…2000). Recently, we reported that chronic glutamate consumed during gestation (1 g/L daily in the drinking water) down‐regulates metabotropic glutamate receptors in brain from pregnant Wistar rat (León Navarro et al. 2005).…”