Effect of Mucine 4 and Fucosyltransferase 1 genetic variants on gut homoeostasis of growing healthy pigs

Abstract

Putative genetic markers have been associated with ETEC F4 (Mucine 4 [MUC4]; MUC4GG;CG as susceptible; MUC4CC as resistant) and F18 (Fucosyltransferase 1 [FUT1]; FUT1GG;AG as susceptible; FUT1AA as resistant) resistances respectively. In this study, 71 post‐weaning pigs were followed from d0 (35 days old) to d42 (77 days of age) to investigate the effect of MUC4 or FUT1 genotypes on the mid‐jejunal microbiota composition, pigs expression of genes related to inflammation (IL8, GPX2, REG3G, TFF3, CCL20 and LBPI) and glycomic binding pattern profile (Ulex europaeus agglutinin I [UEA] fucose‐binding lectin and peanut agglutinin [PNA] galactose‐specific), and on blood plasma targeted metabolomics profile, faecal score and performance parameters of growing healthy pigs. The MUC4 and FUT1 resistant genotypes improved the pigs’ growth performance and had firmed faecal score susceptible genotypes in d0–d21 period. Pigs with MUC4GG genotype had a higher jejunal expression of genes relate to immune function (CCL20 and REG3G) than MUC4CG and MUC4CC pigs (p < 0.05). MUC4CG pigs had higher expression of TFF3 (implicated in mucosal integrity) than MUC4GG and MUC4CC (p < 0.05). FUT1 influenced the alpha‐ and beta‐jejunal microbial indices. The FUT1AA group had a higher number of operational taxonomic units (OTUs) belonging to Lactobacillus genus, while FUT1GG group had a higher number of OTUs belonging to Veillonella genus. MUC4CC pigs had lower scores for UEA on brush borders and goblet cells in villi than MUC4GG (p < 0.05). FUT1AA pigs had lower UEA positivity and higher PNA positivity on brush borders and goblet cells than FUT1AG and FUT1GG (p < 0.05). Both FUT1 and MUC4 influenced the metabolic profile of healthy pigs. Results highlight the role of MUC4 and FUT1 on pig intestinal homoeostasis and improved the knowledge regarding the potential interaction between host genetics, gut microbiota composition and host metabolism in a healthy status.

Variations in porcine colostrum oligosaccharide composition between breeds and in association with sow maternal performance

“…In pigs, a polymorphism was detected that affects the function of a paralogue gene (galactoside 1-L-fucosyltransferase, FUT1) which dictates the presence of this sugar in the small intestine [23]. This is shown by relevant variations in the staining for fucose all along the surface of the intestinal villi and in the Goblet cells [24]. To our knowledge, no study has tested the variability of FUT1 in the porcine mammary gland and we do not know if it is relevant for free OS composition in addition to O-glycans.…”

Contribution of L-Arginine supplementation during gestation on sow productive performance and on sow microbial faecal profile

“…The host-microbial interplay is recently rising the scientific interest. Indeed, the microbiota can influence the host metabolism as it is involved in many functions including the production of volatile fatty acid and vitamin K, can improve energy harvesting capacity and enhance resistance against pathogenic bacteria (Stokes 2017;Luise et al 2019a). These actions can overall contribute to an improvement of the host performance (Mach et al 2015;Yang et al 2017;Kiros et al 2019;Quan et al 2018).…”

“…These actions can overall contribute to an improvement of the host performance (Mach et al 2015;Yang et al 2017;Kiros et al 2019;Quan et al 2018). The diet, together with additional factors such as host genetics and environment (Xiao et al 2016;Luise et al 2019a;Massacci et al 2020) represents one of the main factors able to rapidly modified microbial profile (David et al 2014). Therefore, it can be assumed that supplementation of free Arg can affect the composition of the intestinal microbiota, as observed in mice supplemented with Arg and immunostimulants (Ren et al 2014).…”

“…DNA quantity and quality were evaluated using Nanodrop ND 1000 spectrophotometer (Nanodrop Technologies Inc., Wilmington, DE, USA). The Next Generation Sequencing (NGS) was performed as reported by Luise et al (2019a). Briefly, the DNA was amplified for the V3-V4 hypervariable regions of the 16S rRNA gene amplicons were produced using the primersPro341F: 50-TCGTCGGCAGCGTCAGATGTGTAT AAGAGACAGCCTACGGGNBGCASCAG-30 and Pro805R: 50GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACT ACNVGGGTATCTAATCC-30 using the Platinum TM Taq DNA Polymerase High Fidelity (Termo Fisher Scientific, Italy).…”

Improvement of the Enterotoxigenic Escherichia coli Infection Model for Post-Weaning Diarrhea by Controlling for Bacterial Adhesion, Pig Breed and MUC4 Genotype

“…While the incidence of diarrhea was increased by ETEC infection, sensitivity to PWD was dependent on MUC4 genotype and the occurrence of diarrhea did not reach 100% [ 10 , 11 ]. As differences in MUC4 genotypes appear to affect the composition of gastrointestinal microbiota, MUC4 polymorphisms have been proposed to play roles in intestinal infection [ 12 ], such as PWD.…”