Effect of indel variants within the sorting nexin 29 (SNX29) gene on growth traits of goats

Bi, Yi; Chen, Yuhan; Xin, Dongyun; Liu, Tingting; He, Libang; Kang, Yuxin; Pan, Chuanying; Shen, Weijun; Lan, Xianyong; Liu, Mei

doi:10.1080/10495398.2020.1846547

Cited by 14 publications

(15 citation statements)

References 33 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…As the main types of genetic variations, InDels and CNVs have contributed greatly to MAS. Although previous studies have reported that CNV27 in the SNX29 gene significantly affects the growth traits in goats ( 37 ), and that the two InDels within this gene are significantly correlated with chest width, chest depth, chest circumference and hip width in goats ( 30 ), the relationship between InDel and CNV and litter size of goats has not been studied. Thus, in this study, 11 InDel loci and five CNV loci were retrieved from the database.…”

Section: Discussionmentioning

confidence: 98%

“…Then, 16 primer pairs for amplification were designed using the Primer-BLAST tool in the NCBI database ( https://www.ncbi.nlm.nih.gov/tools/primer-blast/ ) and the primer premier 5.0 software (Thermo Scientific, Waltham, MA, USA) ( Table 1 ). Besides, four pairs of primers including P1-Del-17bp (Rs659002477, TAAAGGAAAGCAATGTA/-), P2-Del-20bp (Rs654310334, AGCTTCCGGTGAGCCTGTCG/-) ( 30 ), MC1R, and GAPDH ( 30 , 31 ) were referred to our previous studies. MC1R and GAPDH were used as reference genes.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Goat SNX29: mRNA expression, InDel and CNV detection, and their associations with litter size

Wang

et al. 2022

Front. Vet. Sci.

Self Cite

View full text Add to dashboard Cite

The sorting nexin 29 (SNX29) gene, a member of the SNX family, is associated with material transport and lipid metabolism. Previous studies have shown that lipid metabolism affects reproductive function in animals. Thus, we hypothesized there is a correlation between the SNX29 gene and reproductive trait. To date, studies on the relationship between the SNX29 gene and reproductive traits are limited. Therefore, the purpose of this study was to examine the polymorphism in the SNX29 gene and its correlation with litter size. Herein, the mRNA expression levels of SNX29 were assayed in various goat tissue. Surprisingly, we found that SNX29 was highly expressed in the corpus luteum, large and small follicles. This result led us to suggest that the SNX29 gene has a critical role in reproduction. We further detected potential polymorphisms in Shaanbei white cashmere (SBWC) goats, including insertion/deletion (InDel, n = 2,057) and copy number variation (CNV, n = 1,402), which were related to fertility. The 17 bp deletion (n = 1004) and the 20 bp deletion (n = 1,053) within the SNX29 gene were discovered to be significantly associated with litter size (P < 0.05), and individuals the ID genotype of P1-Del-17 bp and the DD genotype of P2-Del-20bp had larger litter size. Additionally, the four CNV loci had significant correlations with litter size (P < 0.01) in our detected population. In CNV5, individuals with the median genotype were superior compared to those with loss or gain genotype in term of litter size, and in other three CNVs showed better reproductive trait in the gain genotype. Briefly, these findings suggest that SNX29 could be used as a candidate gene for litter size in goat breeding through marker-assisted selection (MAS).

show abstract

Section: Discussionmentioning

confidence: 98%

Section: Methodsmentioning

confidence: 99%

Goat SNX29: mRNA expression, InDel and CNV detection, and their associations with litter size

Wang

et al. 2022

Front. Vet. Sci.

Self Cite

View full text Add to dashboard Cite

show abstract

“…InDel variants in introns should not be ignored; many InDels located in intron regions of genes significantly affect animal production traits. For example, variants in the introns of SNX29 [ 16 ], IGF2BP [ 14 ], and AKAP12 [ 44 ] significantly affect body traits in animals. Similar to the results of the previous studies, the three InDel loci in this trial were also located in introns, and they significantly correlated with body traits.…”

Section: Discussionmentioning

confidence: 99%

“…In sheep, InDels of IGF2BP1 and PLAG1 also influence growth traits [ 14 , 15 ]. In goats, two InDel variants within the SNX29 gene had significant effects on the growth performance of 1759 goats [ 16 ]. In Shaanbei white cashmere (SBWC) goats, the InDel of the HIAT1 gene has significant effects on chest depth, chest circumference, body length, and hip circumference [ 17 ].…”

Section: Introductionmentioning

confidence: 99%

Relationships between the Mini-InDel Variants within the Goat CFAP43 Gene and Body Traits

Wang

et al. 2022

Animals

Self Cite

View full text Add to dashboard Cite

The cilia- and flagella-associated protein 43 (CFAP43) gene encodes a member of the cilia- and flagellum-associated protein family. Cilia on the cell surface influence intercellular signaling and are involved in biological processes such as osteogenesis and energy metabolism in animals. Previous studies have shown that insertion/deletion (InDel) variants in the CFAP43 gene affect litter size in Shaanbei white cashmere (SBWC) goats, and that litter size and body traits are correlated in this breed. Therefore, we hypothesized that there is a significant relationship between InDel variants within the CFAP43 gene and body traits in SBWC goats. Herein, we first investigated the association between three InDel variant loci (L-13, L-16, and L-19 loci) within CFAP43 and body traits in SBWC goats (n = 1827). Analyses revealed that the L-13, L-16, and L-19 loci were significantly associated with chest depth, four body traits, and three body traits, respectively. The results of this study are in good agreement with those previously reported and could provide useful molecular markers for the selection and breeding of goats for body traits.

show abstract

“…In our previous study, CNV detection was carried out on African meat goats, which showed that CNV27, which was overlapped with the SNX29 gene, was significantly correlated with growth traits such as the chest width of goats [ 18 ]. Recently, the work in our group have shown that SNX29 indels were associated with growth traits in Shaanbei white goats [ 19 ]. These results suggest that SNX29 gene variations could be related to meat quality and productive traits of livestock.…”

Section: Introductionmentioning

confidence: 99%

Effects of Genetic Variation of the Sorting Nexin 29 (SNX29) Gene on Growth Traits of Xiangdong Black Goat

Chen

Yang

Lin

et al. 2022

Animals

Self Cite

View full text Add to dashboard Cite

Previous studies have found that the copy number variation (CNV) and insertion/deletion (indels) located in the sorting nexin 29 (SNX29) gene, which is an important candidate gene related to meat production and quality, are associated with growth traits of African goats and Shaanbei white cashmere goats. However, the genetic effects of SNX29 genetic variation on growth traits of Xiangdong black (XDB) goat (a representative meat goat breed in China) are still unclear. The purpose of this study was to detect the mRNA expression level of SNX29 and to explore the genetic effects of CNV and indel within SNX29 on growth traits and gene expression in XDB goat. The SNX29 mRNA expression profile showed that the SNX29 was highly expressed in adipose tissues, indicating that the SNX29 gene could play a key role in subcutaneous adipose deposition of XDB goat. 17 bp indel (g.10559298-10559314), 21 bp indel (g.10918982-10919002) and CNV were detected in 516 individuals of XDB goat by PCR or qPCR. The association analysis of SNX29 CNV with growth traits in XDB goats showed that SNX29 CNV was significantly correlated with chest circumference and abdominal circumference (p < 0.01), and the normal type of SNX29 CNV goat individuals were more advantageous. For the mRNA expression of SNX29 gene, individuals with SNX29 copy number normal type had a higher trend than that of SNX29 gene with copy number gain type in longissimus dorsi muscle (p = 0.07), whereas individuals with SNX29 copy number gain type had a higher trend in abdominal adipose (p = 0.09). Overall, these results suggested that the SNX29 gene could play an important role in growth and development of XDB goats and could be used for marker-assisted selection (MAS) in XDB goats.

show abstract

Effect of indel variants within the sorting nexin 29 (SNX29) gene on growth traits of goats

Cited by 14 publications

References 33 publications

Goat SNX29: mRNA expression, InDel and CNV detection, and their associations with litter size

Goat SNX29: mRNA expression, InDel and CNV detection, and their associations with litter size

Relationships between the Mini-InDel Variants within the Goat CFAP43 Gene and Body Traits

Effects of Genetic Variation of the Sorting Nexin 29 (SNX29) Gene on Growth Traits of Xiangdong Black Goat

Contact Info

Product

Resources

About