Effect of mutations in the β5–β7 loop on the structure and properties of human small heat shock protein HSP22 (HspB8, H11)

Abstract

The human genome encodes ten different small heat shock proteins, each of which contains the so‐called α‐crystallin domain consisting of 80–100 residues and located in the C‐terminal part of the molecule. The α‐crystallin domain consists of six or seven β‐strands connected by different size loops and combined in two β‐sheets. Mutations in the loop connecting the β5 and β7 strands and conservative residues of β7 in αA‐, αB‐crystallin and HSP27 correlate with the development of different congenital diseases. To understand the role of this part of molecule in the structure and function of small heat shock proteins, we mutated two highly conservative residues (K137 and K141) of human HSP22 and investigated the properties of the K137E and K137,141E mutants. These mutations lead to a decrease in intrinsic Trp fluorescence and the double mutation decreased fluorescence resonance energy transfer from Trp to bis‐ANS bound to HSP22. Mutations K137E and especially K137,141E lead to an increase in unordered structure in HSP22 and increased susceptibility to trypsinolysis. Both mutations decreased the probability of dissociation of small oligomers of HSP22, and mutation K137E increased the probability of HSP22 crosslinking. The wild‐type HSP22 possessed higher chaperone‐like activity than their mutants when insulin or rhodanase were used as the model substrates. Because conservative Lys residues located in the β5–β7 loop and in the β7 strand appear to play an important role in the structure and properties of HSP22, mutations in this part of the small heat shock protein molecule might have a deleterious effect and often correlate with the development of different congenital diseases.

The pivotal role of the β7 strand in the intersubunit contacts of different human small heat shock proteins

“…In order to check this suggestion, we introduced Cys residues into the structure of human αB-crystallin, HspB6 and HspB8 in a position homologous to that of Cys141 of mouse Hsp25 (or Cys137 of human HspB1). The human wild-type αB-crystallin does not contain intrinsic Cys residues and the multiple alignment of human sHsp (Kasakov et al 2007;Michiel et al 2009;Bagneris et al 2009) indicates that Glu117 of αB-crystallin is in a position homologous to that of Cys137 of HspB1. Therefore, we introduced the single-mutation E117C into the structure of human αB-crystallin (Fig.…”

“…1a). HspB6 contains the single Cys46 in the variable N-terminal end and Glu116 in a position homologous to Cys137 of HspB1 (Kasakov et al 2007;Michiel et al 2009;Bagneris et al 2009). To exclude the effect of Cys46 of HspB6 on the subunit interaction we replaced this residue by Ser and mutated Glu116 to Cys, thus obtaining the so-called Cysmutant (C46S/E116C) of HspB6 (Fig.…”

“…Recombinant wild-type untagged human HspB6, HspB8 and HspB1 were expressed and purified as described earlier (Kasakov et al 2007;Bukach et al 2003). The full-length cDNA of αB-crystallin was amplified from MarathonReady Brain cDNA (Clontech) using the following forward GAGATATACAT ATGGACATCGCCATCCACCACC and reverse ATTGCTCGAGCTATTTCTTGGGGGC TGCGGT GACAG primers containing NdeI and XhoI restriction sites (underlined) and Pfx Platinum DNA polymerase (Invitrogen).…”

“…Up until now, the structure of only three sHsp, namely Methanococcus jannaschii Hsp16.5 (Kim et al 1998), wheat Triticum aestivum Hsp16.9 (van Monfort et al 2001) and Tsp36 of parasitic flatworm Taenia saginata (Stamler et al 2005) was described in the literature. Although the primary structure of human sHsp is similar to that of sHsp isolated from other species, there are certain important differences both in the conserved α-crystallin domain and in the variable N-and C-terminal ends (van Monfort et al 2001;Mchaourab et al 2009;Kasakov et al 2007;Michiel et al 2009). This complicates direct comparison of the structure of already crystallized sHsp (Kim et al 1998;van Monfort et al 2001;Stamler et al 2005) with their human counterparts.…”

“…Finally, the data obtained up to now predominantly illuminate structural properties of human αB-crystallin (HspB5) and to a smaller extent of HspB1 and HspB6. At the same time, the members of human sHsp family have a rather diverse structure of both αB-crystallin domain and of variable Nand C-terminal ends (Stamler et al 2005;Kasakov et al 2007;Bagneris et al 2009). This makes desirable systematic investigation of intersubunit interaction of different full size human sHsp.…”